ID: 1115378709

View in Genome Browser
Species Human (GRCh38)
Location 14:32708813-32708835
Sequence CTGAGGAAAGCTAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 574}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115378709 Original CRISPR CTGAGGAAAGCTAAGGAGGA AGG (reversed) Intronic
900472395 1:2861284-2861306 CTGAGGAGAGCAAACCAGGAGGG + Intergenic
900860369 1:5224726-5224748 GTGAGGAAAGCAAAGGGGGCAGG + Intergenic
901186834 1:7379028-7379050 CTCAAGAAAGCCAGGGAGGAGGG - Intronic
901551023 1:9996455-9996477 CAGAGAAAAGCAAAGGAGAAGGG - Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902981261 1:20125003-20125025 CAGAGGGAAGCAAAGGAGAAGGG + Intergenic
903067368 1:20708114-20708136 CTGAGGACAGATCAGGAGGGAGG - Intronic
903363650 1:22792850-22792872 CTGAGGAAAGCAGAGCAGGCAGG + Intronic
903775115 1:25788148-25788170 CTTTGGAAAGCTGAGGCGGAAGG - Intergenic
903893180 1:26583830-26583852 CTGAGAAAAGCTGAGGTGGGAGG + Intergenic
903934091 1:26882872-26882894 CTGAGGCAGGAAAAGGAGGAGGG - Intronic
904689896 1:32286026-32286048 CTGAGGAAAGAAAAGTAGGTGGG - Exonic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905273423 1:36801790-36801812 CAGAGGAAAGCAAAGGAGATTGG - Exonic
905659476 1:39710397-39710419 CTGAGGTATGCCAAGGAAGAAGG - Intronic
906655972 1:47548580-47548602 CTGGGGAAAGCTGTGAAGGAAGG - Intergenic
907181480 1:52574052-52574074 CTTTGGAAGGCCAAGGAGGAAGG + Intergenic
907284305 1:53370360-53370382 CTGAGGAAAGCTCAGGAGGGAGG + Intergenic
910784397 1:90979226-90979248 CTTCGGAAGGCTAAGGAGGGTGG + Intronic
910878344 1:91899272-91899294 CTTTGGAAAGCTTAGGCGGAAGG + Intronic
912243630 1:107938302-107938324 TCAAGGAAAGCTGAGGAGGAAGG + Intronic
913010443 1:114677845-114677867 TTGAGGAAAGGGAAGAAGGAAGG - Intronic
913223629 1:116679535-116679557 CTGAGGACAGCTGTGGGGGAAGG + Intergenic
914394326 1:147250540-147250562 CAGGGGAAAGCTAAGGGGTAGGG + Intronic
914799887 1:150953134-150953156 TTGAGGACAGCTACTGAGGAGGG + Intronic
915792258 1:158686086-158686108 CTGAGGTAAGCTAGGGAAAATGG - Intronic
916226313 1:162493204-162493226 CTTTGGGAGGCTAAGGAGGAAGG + Intergenic
916383383 1:164238858-164238880 CAGAGTATAGCTAGGGAGGAAGG - Intergenic
916391019 1:164330993-164331015 CTGATGAAAGCAAGGAAGGAGGG - Intergenic
916417630 1:164607476-164607498 CTGAAGAAAGCTACTGAGGAAGG + Intronic
916890319 1:169106836-169106858 CGCGGGAAAGCCAAGGAGGAGGG + Exonic
918454123 1:184689440-184689462 CTGGGGACAGCAGAGGAGGAAGG - Intergenic
918831730 1:189406695-189406717 CTCAGGAAAGCTGAGGTGGGAGG - Intergenic
919029505 1:192222538-192222560 CTTAAGTAAGCTAAGGAGGATGG - Intergenic
919204342 1:194401680-194401702 GTGAGGAGAGGAAAGGAGGAGGG + Intergenic
920039249 1:203085221-203085243 CTGAAGAAAGATCAGGAGCAAGG - Intronic
920291608 1:204927629-204927651 TTTGGGAAGGCTAAGGAGGAGGG - Intronic
920676383 1:208041256-208041278 TAGAGGAAGGCTAAAGAGGAGGG + Intronic
920930268 1:210381522-210381544 CTTTGGAAAGCTAAGGTGGGTGG - Intronic
921663525 1:217837551-217837573 CTGATGAAAGTTAAGGAAAATGG + Intronic
921740438 1:218678543-218678565 ATGAGGAAATAAAAGGAGGAAGG - Intergenic
922067970 1:222162534-222162556 CTCAGGAAAGATAAAGATGAAGG - Intergenic
923084030 1:230688608-230688630 GTTAGGAAAGCCAAAGAGGAAGG + Intronic
923945142 1:238877401-238877423 CGGAGGAAAGGTAGGGAGGAGGG - Intergenic
924429176 1:243982199-243982221 GTGAGAAAAGCTAAGCAGTATGG - Intergenic
924728760 1:246693036-246693058 CTTTGGAAGGCCAAGGAGGAAGG - Intergenic
924851004 1:247830439-247830461 CTGAGGCAAGCCCAGGAAGAAGG + Intergenic
1062841702 10:678275-678297 CAGAGGAAAGCTGGGAAGGATGG - Intronic
1062876931 10:950017-950039 CTGTGGAAGGCCAAGGAGGGTGG - Intergenic
1063096573 10:2913638-2913660 CTGAGGAAGGCAGAGTAGGAAGG + Intergenic
1063457720 10:6196011-6196033 CTTATGAAAGCAAAAGAGGAAGG - Intronic
1063485961 10:6421239-6421261 CTTTGGAAGGCTAAGGGGGAAGG + Intergenic
1063588303 10:7372842-7372864 CTGAGGCCAGACAAGGAGGATGG - Intronic
1063590143 10:7387632-7387654 AAGAGGAAACCAAAGGAGGATGG + Intronic
1063907751 10:10798427-10798449 CCAAAGAAAGCCAAGGAGGACGG + Intergenic
1064341413 10:14489006-14489028 CAGAGGGAAGCTAGGGAGGAGGG + Intergenic
1064948014 10:20814350-20814372 CTTTGGAAAGCTAAGGTGGGAGG + Intronic
1065665669 10:28057489-28057511 TGGCGGAAAGCAAAGGAGGAGGG - Intronic
1066008869 10:31173948-31173970 TTGGGGAGAGCTAAGGAGGATGG - Intergenic
1066489550 10:35881757-35881779 CTTTGGAAGGCTGAGGAGGAAGG + Intergenic
1068178778 10:53495264-53495286 CTGAGAAAAGCAATGGGGGAAGG - Intergenic
1068759141 10:60688597-60688619 ATGAGGAAAGCAAAGCAAGAGGG + Intronic
1069420373 10:68241443-68241465 CTTTGGGAACCTAAGGAGGAGGG - Intergenic
1070021988 10:72595884-72595906 CTTGGGGAAGCTGAGGAGGAAGG + Intronic
1070199151 10:74186282-74186304 CTGTGGAAAGGAAAGGAGAAGGG - Intronic
1070649883 10:78227757-78227779 CTGAGGTCAGCTAAGAAGAAGGG - Intergenic
1070786889 10:79167087-79167109 CTGAGGAAGGCTTCCGAGGATGG - Intronic
1071183977 10:83019478-83019500 AGGAGGCCAGCTAAGGAGGAGGG - Intergenic
1071425044 10:85540925-85540947 CTGAAGAACGCTCAGGAGAATGG - Intergenic
1071957898 10:90779080-90779102 CTGATGAAAGGCCAGGAGGAAGG + Intronic
1072435818 10:95414141-95414163 CTGAGGAAAGCTAAGAATTATGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1074440339 10:113472242-113472264 ATGGGGACATCTAAGGAGGAAGG + Intergenic
1075084275 10:119403876-119403898 CTTTGGAAAACTAAGGAGGGTGG - Intronic
1075086452 10:119417309-119417331 CTGAGGCAGGCTGGGGAGGAGGG - Intronic
1075244954 10:120812838-120812860 TTGAGGAAAGGTAAGAAGGAAGG - Intergenic
1075424083 10:122328019-122328041 CTGGGCAAGGCTAGGGAGGACGG + Intronic
1075485116 10:122815435-122815457 AGGAGGAAAGCGAAGGAGGGAGG - Intergenic
1075638489 10:124047151-124047173 CTCAAGAATACTAAGGAGGATGG + Intronic
1075988368 10:126809285-126809307 CTTTGGAAAGCTGAGGTGGAAGG - Intergenic
1076261860 10:129072832-129072854 CTGATGGTAGCCAAGGAGGAAGG + Intergenic
1077876484 11:6312753-6312775 CTGAGGAAGGGTATGAAGGAGGG + Intergenic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078938863 11:15977812-15977834 TTGAGGAAAGTTAAGAAGGTAGG - Intronic
1079023005 11:16924526-16924548 TTTAGGAAGGCAAAGGAGGAGGG + Intronic
1079041367 11:17063427-17063449 CTGTACAAAGCTAAGGAGGCAGG - Intergenic
1079204211 11:18399836-18399858 CTTCGGAAGGCTAAGGAGGGAGG - Intronic
1079275952 11:19037957-19037979 CTGAAGCAAGCCAAGGAAGAAGG - Intergenic
1079750846 11:24194844-24194866 CTTTGGAAGGCCAAGGAGGATGG + Intergenic
1080004141 11:27387381-27387403 CTGAGGGACTCTGAGGAGGAGGG + Intronic
1080171424 11:29307736-29307758 CTTAGGCAAGGTATGGAGGAGGG + Intergenic
1080260945 11:30349332-30349354 AGGAAGAAAGCAAAGGAGGATGG - Intergenic
1080427879 11:32172976-32172998 CTGAGGAAAGCCAAGTAGGCTGG + Intergenic
1080515310 11:33014909-33014931 GTGAGGAGAGAAAAGGAGGAAGG - Intergenic
1081900898 11:46626994-46627016 CTGTGGAAAGCCGAGGTGGATGG + Intronic
1082850686 11:57761773-57761795 CTTAGGAAAGCGAAGGGGGTAGG + Intronic
1083243822 11:61410098-61410120 CTGAAAAAAGGTAGGGAGGAGGG - Intronic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1083787270 11:64958370-64958392 CTTTGGAAAGCTAAAGAGGGAGG + Intronic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084454176 11:69257890-69257912 CTAAGGGCAGCTTAGGAGGAAGG + Intergenic
1085214092 11:74812547-74812569 CTTTGGAAAGCTAAGGTGGGAGG - Intronic
1085605104 11:77890451-77890473 CTCAGGAAAGGAAAGGAGAAGGG - Intronic
1085644421 11:78213864-78213886 CTGAGGGAAGCTGTGGAGGCAGG + Exonic
1085880325 11:80459922-80459944 CTTTGGAAAGCCAAGGAGGGTGG - Intergenic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1087069967 11:94068598-94068620 CTTAGCAAAGCTAAGGAGGTGGG + Intronic
1087664001 11:101021194-101021216 CTTTGGAAAGCTGAGGAGGGTGG - Intergenic
1088377984 11:109162672-109162694 TTGAGAGAGGCTAAGGAGGATGG - Intergenic
1089079845 11:115766481-115766503 AGGAGGAAAGCTCAGGAGGCTGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089469233 11:118707536-118707558 TTGGGGACAGCTAAGGAGGTGGG - Intergenic
1090356785 11:126146052-126146074 CCGAGGACAGCTACGGGGGAAGG - Intergenic
1090623550 11:128584849-128584871 GGGAGGAAAGGGAAGGAGGAGGG + Intronic
1092209611 12:6637867-6637889 CTGAGGAAGGCCAAGAAGGCTGG - Intergenic
1092406177 12:8223581-8223603 CTGGGGAAAACCAGGGAGGACGG - Intronic
1093378473 12:18460328-18460350 CTTTGGAAGGCCAAGGAGGACGG + Intronic
1093728794 12:22544584-22544606 CCGAGGAAAGATAAGGGGGCGGG + Intergenic
1094488668 12:30945105-30945127 CTGAGGGCAGAAAAGGAGGAGGG - Intronic
1095114813 12:38340675-38340697 CTCAGGAAAGTGAAGTAGGAAGG - Intergenic
1095606224 12:44070902-44070924 ATGAAGAAAGCCAAGGAGTAAGG + Intronic
1096423616 12:51481842-51481864 CTCAGGAAGGCTGAGGTGGAAGG + Intronic
1096578097 12:52567159-52567181 CTGATGACAGCTGAGGAGGAGGG + Exonic
1097123101 12:56751527-56751549 CTTTGGAAAGCCGAGGAGGACGG - Intronic
1098384679 12:69906404-69906426 CTGAGCAAAACTAGGGGGGAAGG + Intronic
1099374629 12:81884257-81884279 CTGAGGGAATCAAAGGAAGAGGG + Intergenic
1099405696 12:82259385-82259407 TTAAGGAAAGTTAACGAGGATGG - Intronic
1099650122 12:85415906-85415928 CTGAGGAAAATCAAGGTGGAAGG + Intergenic
1101240597 12:102834456-102834478 CTTGGGAAAGCCAAGGAGGCAGG - Intergenic
1101493169 12:105229055-105229077 CTGAGGGAAGTTCAGGATGAGGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102570347 12:113823535-113823557 ATGAAGAAAGATAAGGAGTAGGG + Intronic
1102954191 12:117048814-117048836 CTGAGGAATGTTTAGGATGAAGG + Intronic
1103085296 12:118058230-118058252 CTGAGGAAAGCTTTTGAGGCCGG - Intronic
1103589404 12:121980589-121980611 CTGTGGGAGGCTAAGGAGGGTGG - Intronic
1103678014 12:122671833-122671855 CTTCGGAAAGCTGAGGTGGAAGG - Intergenic
1104472990 12:129045579-129045601 CAGAGGAAAGCTAAGCCAGACGG + Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105331342 13:19419302-19419324 CTGAGCAAATCTAAGCAGAAGGG + Intergenic
1105367203 13:19776215-19776237 CTTTGGGAAGCTGAGGAGGAGGG + Intronic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106412050 13:29517301-29517323 ATGAGAACAGCTAAGGGGGAAGG + Exonic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1107868302 13:44725125-44725147 CTAAGGAAAACTCAGGTGGATGG + Intergenic
1109177949 13:59178496-59178518 CTGAGGAAGCCTAAAGAAGAAGG + Intergenic
1109239557 13:59868718-59868740 CTGAGGAGAGGGAAGAAGGAAGG - Intronic
1109511664 13:63384320-63384342 GAGAGGGAAGCAAAGGAGGAGGG - Intergenic
1109604916 13:64680249-64680271 CTTTGGAAGGCTAAGGAGGGTGG - Intergenic
1109702049 13:66038970-66038992 GGGAGGAAAGAAAAGGAGGAAGG - Intergenic
1109778315 13:67073246-67073268 CAGAGCAAAGCTAAGGTGAATGG + Intronic
1110017504 13:70426341-70426363 CAGAGGAATGCTAGGGAGAAGGG + Intergenic
1110425028 13:75357429-75357451 CAGAGGAAAGCAGATGAGGATGG - Intronic
1110474635 13:75899823-75899845 CTGTGAGAAGCTAAGGAGGGCGG + Intergenic
1111960231 13:94802058-94802080 CTTTGGAAGGCCAAGGAGGAAGG + Intergenic
1112289442 13:98132225-98132247 CTGAGGAAGAATAAGGAGGTGGG - Intergenic
1112792458 13:103017521-103017543 CTGAGGAAAGCCAGGTAGGAAGG + Intergenic
1113132496 13:107053612-107053634 CTGAGGAAATCTTCAGAGGAGGG + Intergenic
1113387385 13:109861454-109861476 CTTTGGGAAGCTGAGGAGGATGG + Intergenic
1113642609 13:111968842-111968864 CTGAGGAAAGCTAGATGGGAGGG + Intergenic
1114260929 14:21035633-21035655 CTCAGTATAGCTCAGGAGGAGGG + Intronic
1114544141 14:23486216-23486238 CTGAAGGAAACTAAGAAGGAGGG - Intronic
1115229783 14:31147511-31147533 CTTTGGAAGGCTAAGGAGGGTGG + Intronic
1115378578 14:32706735-32706757 CTGGGGTAAGCAAAGAAGGAAGG + Intronic
1115378709 14:32708813-32708835 CTGAGGAAAGCTAAGGAGGAAGG - Intronic
1116115754 14:40648000-40648022 CTTTGGAAAGCTGAGGTGGAAGG - Intergenic
1116989619 14:51261795-51261817 CTGAAGTAAGCCAGGGAGGAAGG + Intergenic
1118201323 14:63676650-63676672 CTTTGGAAGGCCAAGGAGGATGG - Intergenic
1118350689 14:64971328-64971350 CTGAGGGAGGCTAAAGAGGATGG - Intronic
1118383984 14:65239940-65239962 ATGGGGAAAGCTAATTAGGAAGG + Intergenic
1118733913 14:68688963-68688985 CTGAGCATGGCTGAGGAGGAGGG + Intronic
1118913270 14:70079686-70079708 CTGAGGAAAATGAAGGGGGAGGG - Intronic
1119253997 14:73182598-73182620 CTGTGGGAGGCTAAGGAGGGTGG + Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119620203 14:76126133-76126155 CTGAGGAAAACTATTGGGGAAGG + Intergenic
1119817243 14:77580612-77580634 CTTCGGGAAGCTAAGGTGGAAGG + Intronic
1119835304 14:77744207-77744229 CTTTGGGAAGCTGAGGAGGATGG + Intronic
1121029091 14:90642713-90642735 CAGAGGAAAGATAAGAAGGTAGG + Intronic
1121285736 14:92734374-92734396 CTTAGGAAAGCGGAGGCGGATGG + Intronic
1121300935 14:92870316-92870338 ATGAGGAAACCTAAGAAAGAAGG - Intergenic
1121301133 14:92872097-92872119 ATGAGGAAACCTAAGAAAGAAGG - Intergenic
1122123775 14:99568408-99568430 GAGAGGAAGGCCAAGGAGGAAGG - Intronic
1122524866 14:102374516-102374538 CTTGGGGAAGCTGAGGAGGAAGG + Intronic
1123131413 14:105988580-105988602 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1202828940 14_GL000009v2_random:5046-5068 CTGAGGAAAGCCATGGAAAACGG - Intergenic
1123438391 15:20272472-20272494 CTGAGGGGAGCAGAGGAGGAGGG - Intergenic
1123581646 15:21719777-21719799 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1123618295 15:22162400-22162422 TAGAGGAAGGCTGAGGAGGAGGG + Intergenic
1124220284 15:27845295-27845317 TGGAGGAAAGCTAAGGAGAATGG + Intronic
1125373208 15:39000293-39000315 CAGAGGAAATCCTAGGAGGAGGG + Intergenic
1125757766 15:42075880-42075902 CTGAGGAAAGGAAGGGAGGGAGG + Intronic
1125762399 15:42105498-42105520 CTGAGGACACCCAGGGAGGATGG + Intergenic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126303811 15:47231124-47231146 AAGAGGAAAGCAGAGGAGGAAGG - Intronic
1128100245 15:64992670-64992692 CTGAGGGAAGCCAAGGCGGGTGG + Intergenic
1128733290 15:70035062-70035084 ATGAGGAAGGCCATGGAGGAGGG - Intergenic
1129218887 15:74119543-74119565 GTGAGGAAGGGTAAGGGGGAGGG - Intronic
1129553470 15:76479161-76479183 ATGAGGAAAAAAAAGGAGGAGGG + Intronic
1129700249 15:77763586-77763608 CTGAGGAGAGCTATGGGGGAAGG - Intronic
1130022273 15:80241574-80241596 CAGAGCAAAGCAAAGGAGAATGG - Intergenic
1130033173 15:80333981-80334003 CAGAGGAATGCTGGGGAGGAGGG + Intergenic
1131867170 15:96723500-96723522 CTGAGGAAAGCTACCGTGGTAGG + Intergenic
1132269818 15:100513778-100513800 CTTTGGAAAGCTGAGGTGGAAGG - Intronic
1132822696 16:1883757-1883779 CTTTGGAAAGCCAAGGAGGGAGG + Intronic
1133444870 16:5851412-5851434 CAGAGGAAAATTAAGGAGGAGGG - Intergenic
1133632839 16:7638240-7638262 CTTAAGAAAGCTAATGAGAAGGG - Intronic
1133863236 16:9616691-9616713 CTTAGGAAAACTGATGAGGAAGG - Intergenic
1133935693 16:10267487-10267509 CTTTGGGAAGCTGAGGAGGATGG + Intergenic
1134599028 16:15518856-15518878 GGGAGGAAAGAAAAGGAGGAAGG + Intronic
1135434063 16:22413410-22413432 CTTTGGGAGGCTAAGGAGGAAGG - Intronic
1135758086 16:25114703-25114725 CTGAGGAAAGGTCAGGGTGAAGG - Intronic
1135923484 16:26672065-26672087 CTCAGAACAGCCAAGGAGGAAGG + Intergenic
1136255018 16:29032760-29032782 CTTTGGGAAGCTAAGGAGGGTGG + Intergenic
1136415671 16:30102011-30102033 CTAAGGAAAGCTCAGAGGGAAGG + Intergenic
1136598805 16:31270125-31270147 GAAAGGAAAGCAAAGGAGGAAGG - Intronic
1136620579 16:31425922-31425944 CTGTGGGAAGCTGAGGAGGGTGG - Intronic
1138231723 16:55342448-55342470 CTGTGGAAAGCCAAGGTGGGAGG + Intergenic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1138313539 16:56048912-56048934 CTGAAGTAAGAAAAGGAGGAAGG - Intergenic
1138482658 16:57314068-57314090 CTGAGGAAAGGGAATGAGAAGGG + Intergenic
1138703384 16:58888683-58888705 CTGATGAAATCTAAGGAAGTAGG - Intergenic
1139339989 16:66262286-66262308 GTGAAGAAAGCTAATGAGGTGGG + Intergenic
1139447521 16:67006946-67006968 CTGAGGAAAGCTGAAGAAGAAGG - Intronic
1139462747 16:67135713-67135735 CTTTGGAAAGCCAAGGAGGGAGG - Intronic
1139818137 16:69693928-69693950 CTGAGGAGAGCTATGGAACAAGG - Exonic
1141308987 16:82894880-82894902 CTGAGAAATGCCAAGAAGGAAGG + Intronic
1141876026 16:86825176-86825198 CTGAGAAGAGCCGAGGAGGAAGG - Intergenic
1142341195 16:89523912-89523934 CTCAGGAAAGCTCAGCTGGACGG - Intronic
1142473931 17:179104-179126 CTCAGAGGAGCTAAGGAGGACGG - Intronic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1143052428 17:4137219-4137241 CCTAGGAGAGCTATGGAGGAAGG - Intronic
1143320174 17:6063248-6063270 CTAAGGAAAGGCAGGGAGGAGGG - Intronic
1143571498 17:7761726-7761748 CTGAGGGAGGCTAAGGTGGGTGG - Intronic
1143948478 17:10614806-10614828 CTGAGGAGAGCTGAGGAGAGTGG - Intergenic
1144610376 17:16706893-16706915 CTGGGGAAAGATGAGGATGAGGG + Intronic
1144902366 17:18608522-18608544 CTGGGGAAAGATGAGGATGAGGG - Intergenic
1144928696 17:18837456-18837478 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145032562 17:19516058-19516080 CTTAGGAAGGCCAAGGTGGAGGG + Intronic
1145130132 17:20337581-20337603 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145836925 17:27961363-27961385 CTCTGGAAGGCTAAGGTGGAAGG + Intergenic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1146875856 17:36410270-36410292 CTCAGGAAGGCTAAGGCAGAAGG - Intronic
1147063531 17:37902599-37902621 CTCAGGAAGGCTAAGGCAGAAGG + Intergenic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1147373149 17:40007703-40007725 CTTAGGGAGGCTAAGGTGGAAGG + Intergenic
1147374519 17:40015885-40015907 GTGGGGAGAGCTAAGGGGGATGG + Intronic
1148549292 17:48541263-48541285 TTAAAGAAACCTAAGGAGGATGG + Intronic
1148585378 17:48774887-48774909 CTTTGGAAGGCTGAGGAGGATGG + Intronic
1148969751 17:51469514-51469536 CTGAGGACAGCTAAAGAGGGAGG + Intergenic
1149006081 17:51806944-51806966 TTGAAGGAAGCTAAGGAGCAGGG + Intronic
1149634489 17:58155837-58155859 CTCGGGAAAGGCAAGGAGGAAGG + Exonic
1149734024 17:58975391-58975413 CTGTGGAAGGCCAAGGAGGGAGG + Intronic
1149834431 17:59899919-59899941 CTTTGGGAAGCTAAGGTGGAAGG + Intronic
1150517326 17:65827222-65827244 CTGTGGCAAGCTGAGGAGCAGGG - Intronic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1150998240 17:70343774-70343796 ATGAGGAAAGATAAAAAGGAAGG + Intergenic
1151233534 17:72701855-72701877 CTGTGGGAAGCTGAGGTGGAAGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1153248580 18:3097648-3097670 CTTAGGAAAGCCAAGGCGGGAGG - Intronic
1153971338 18:10229778-10229800 CTGAGGAAAGCAGAAGTGGAGGG - Intergenic
1154040419 18:10849512-10849534 CTGAGCAAAGCAAAGGAGCCGGG - Intronic
1154494579 18:14946112-14946134 CTCAGGAAAGTTAAAGAGGTAGG - Intergenic
1155077213 18:22369450-22369472 CTGTGGGAAGCTAAGGCAGAAGG + Intergenic
1155207413 18:23572588-23572610 CTTAGGAAGGCTGAGGAGGGTGG + Intronic
1155283606 18:24266214-24266236 GTGGGGAAAGCCAGGGAGGAAGG - Intronic
1155849910 18:30761183-30761205 CTTTGGAAAGCTGAGGAAGAAGG + Intergenic
1156333933 18:36151559-36151581 CTTAGGAAAGCTGAGGTGGATGG + Intronic
1157336426 18:46741856-46741878 CTTTGGGAGGCTAAGGAGGATGG + Intronic
1158776993 18:60594743-60594765 CTGAGGAAAGCTAGGAACCAAGG - Intergenic
1159206261 18:65256835-65256857 CTGGGGAGAGCTAAAGAGAAAGG + Intergenic
1160383654 18:78479795-78479817 CTGAGGAAAGAAAAGGAGAAAGG - Intergenic
1161205582 19:3039562-3039584 CTGAGGGAAGCTGAGCAGGTAGG - Intronic
1163138024 19:15327293-15327315 CTTTGGAAAGCTAAGGTGGGTGG + Intronic
1163816045 19:19465144-19465166 TTGAGGAAGGCTAGGCAGGAGGG - Intronic
1164065855 19:21716412-21716434 CTTTGGAAGGCTAAGGAGGGTGG - Intergenic
1164162058 19:22633723-22633745 CTTTAGGAAGCTAAGGAGGATGG + Intergenic
1164458829 19:28430555-28430577 CTTTGGAAAGCTGAGGAGGGAGG + Intergenic
1164769354 19:30796110-30796132 CTTAGGAAAGCTGAGGGGGGAGG + Intergenic
1165498632 19:36169865-36169887 CTTTGGGAAGCTAAGGCGGATGG + Intergenic
1165965980 19:39581250-39581272 GAGAAGAAAGCAAAGGAGGAAGG + Intergenic
1166707197 19:44914615-44914637 CAGGGGAAGGCTCAGGAGGAGGG + Intronic
1166709302 19:44926711-44926733 CAGGGGAAGGCTCAGGAGGAGGG + Intergenic
1166909514 19:46141949-46141971 CTGAGGAGAGCAAATGAGCAAGG - Intergenic
1167049144 19:47068061-47068083 CTGAGGAGAGCTGGGGAGCATGG - Intronic
1167153961 19:47726783-47726805 TTGGGGCAGGCTAAGGAGGAAGG - Intronic
1168112686 19:54202939-54202961 CTTTGGAAAGCTGAGGTGGATGG - Intronic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
926026498 2:9549760-9549782 TTTTGGAAAGCTAAGGGGGAAGG - Intronic
926046896 2:9716590-9716612 CTTTGGAAAGCTAAGGTGGGAGG + Intergenic
926128488 2:10286117-10286139 CAGAGGGAAGCTGAGGAGGGCGG + Intergenic
926318211 2:11727136-11727158 CTAAGGGAAGCTAAGGCGAATGG - Intronic
926677607 2:15639356-15639378 CTTTGGGAAGCTGAGGAGGATGG - Intergenic
926819410 2:16836077-16836099 TGGAGTAGAGCTAAGGAGGATGG + Intergenic
926958896 2:18332531-18332553 GTGAGGGAAGCCAAGGAGGGGGG - Intronic
927057454 2:19379190-19379212 CTGAGCAGAGCTCAGGAGCAGGG + Intergenic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927463933 2:23323182-23323204 CTGTGTAAAGCTAAGGAGCTCGG + Intergenic
927710810 2:25324740-25324762 CTGGGGATGGATAAGGAGGAGGG + Intronic
927726933 2:25432807-25432829 CTGAGGAAACCAAAGGAGTGGGG - Intronic
928455484 2:31416827-31416849 CTGGGGAATGCCTAGGAGGAAGG - Intergenic
928989301 2:37215398-37215420 CTGAGGAAAACTAAGAAATAAGG + Intronic
929288711 2:40165052-40165074 CATAAGAAAGCCAAGGAGGAAGG + Intronic
929747952 2:44678762-44678784 CTGAGAAAAGATGAGAAGGAAGG - Intronic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930116121 2:47719822-47719844 CTGAGGCAGGATAGGGAGGAGGG + Intronic
930146250 2:48008015-48008037 AAGAGGAAAGGAAAGGAGGAAGG - Intergenic
931260665 2:60615583-60615605 CTGTGGAAAGCTGAGAAGGCTGG + Intergenic
931492562 2:62764642-62764664 CTGTGGAAAGCTGAGGAGTGTGG + Intronic
931586421 2:63834763-63834785 CTGAGCACAGCCAAGGAGGTAGG - Intergenic
934696946 2:96406722-96406744 CTGAGGATGGCTGAGGGGGAAGG + Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
935336073 2:102018177-102018199 CTGTGGGAAGCTGAGGTGGAAGG - Intronic
936232293 2:110713432-110713454 CTAAGGAGAGCTCATGAGGAAGG - Intergenic
936882064 2:117265524-117265546 CTTATGAAAGCTACGGAGAAAGG + Intergenic
936959807 2:118061293-118061315 ATGTGGAAAGCATAGGAGGAGGG - Intergenic
940138721 2:150469381-150469403 CTGAAGATAGCTGAGTAGGATGG - Exonic
940366904 2:152858473-152858495 CTTTGGGAAGCTAAGGAGGGTGG - Intergenic
941513190 2:166438780-166438802 CTGAGGAAAATTAAGCTGGAAGG + Intronic
941546845 2:166861520-166861542 TTGGGGAATGCTAAGAAGGAGGG + Intergenic
941658985 2:168175096-168175118 CTGTGGAATCCTCAGGAGGAAGG - Intronic
941918664 2:170828571-170828593 GTGAGGACAGCAGAGGAGGACGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942133876 2:172906535-172906557 CTGATGATAGCCCAGGAGGAGGG + Intronic
942846935 2:180438092-180438114 CTAAGGAAAGAAAAGGAGGTAGG + Intergenic
943284647 2:185982090-185982112 CTGAGGAAAGATAAGTGAGAAGG + Intergenic
943356960 2:186867796-186867818 TAGAGGAAAGATAAAGAGGAAGG + Intergenic
943895843 2:193358722-193358744 CTGACTAAAACCAAGGAGGAAGG - Intergenic
944249534 2:197567372-197567394 CTTTGGAAGGCTGAGGAGGAAGG - Intergenic
944827357 2:203498491-203498513 ATGAGGAAAGCTAATCAGAAAGG + Intronic
945086306 2:206135971-206135993 CTGACGACAGCAAAGCAGGAAGG + Intronic
945189853 2:207176292-207176314 CAAAGGAAAGCTAAAGAGTAAGG + Intergenic
946522286 2:220479434-220479456 CTGAGGGAGGCTGAGGTGGAAGG + Intergenic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
946829451 2:223712924-223712946 CTGAGGAAAGCTCATTAAGAAGG + Intergenic
947379991 2:229536193-229536215 CTGAGGAAGGCTGAGGAGGTTGG + Intronic
947869812 2:233428311-233428333 CTGTGGGCAGCTAAGAAGGATGG + Intronic
948358672 2:237401926-237401948 CTTAGGAAGGCTAAGGTGGAAGG - Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948934481 2:241153713-241153735 CTGAGGACCCCTAAGGAGCACGG - Intronic
1168884867 20:1242064-1242086 CTGAGGAAAGGTGGGGAAGAGGG - Intronic
1168961878 20:1875645-1875667 ATGAGCAAAGGTAAGGAGGGAGG - Intergenic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1170096324 20:12649622-12649644 ATGAAGAAAGGAAAGGAGGAGGG + Intergenic
1170159229 20:13295629-13295651 CCCAGGAAAGATAAAGAGGAAGG + Intronic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171495704 20:25553714-25553736 CCCAGGGAAGCTAAAGAGGAAGG + Intronic
1172302218 20:33858136-33858158 GGGAGGAAAGGGAAGGAGGAAGG + Intergenic
1172411291 20:34725369-34725391 CTGAGCTAAGATAAGTAGGAAGG + Intronic
1172507964 20:35478009-35478031 CTGCAGAAAGCTGAGGAGGCTGG + Exonic
1173601456 20:44298545-44298567 GTGAGCAAAGCTAAGGACGAAGG - Intergenic
1173808694 20:45942854-45942876 CTTTGGAAGGCTAAGGTGGAAGG - Intronic
1173833340 20:46107813-46107835 CTTTGGGAAGCCAAGGAGGAAGG - Intergenic
1174161992 20:48557713-48557735 GGGAGGTCAGCTAAGGAGGAAGG + Intergenic
1174276796 20:49409857-49409879 CTGAGCAAAGGTAGGGAGGCAGG - Intronic
1174316419 20:49705934-49705956 CTTTGGAAGGCCAAGGAGGACGG + Intronic
1175261630 20:57678196-57678218 CTGGGGAAAGGTAAGGTTGATGG + Intronic
1176608123 21:8849874-8849896 CTGAGGAAAGCCATGGAAAACGG - Intergenic
1177393905 21:20509322-20509344 CTGAGGAAAGTGAAGGACAAAGG - Intergenic
1177648689 21:23933469-23933491 ATGAGGAAAGGAAAGGAGGATGG - Intergenic
1177735636 21:25085491-25085513 CTGAGGAAATCAAAGCAGTAAGG - Intergenic
1178074812 21:29005272-29005294 CTGAGGCAAGCCCAGGAGCAGGG + Exonic
1178323503 21:31624395-31624417 CTCAGGAAAGCCCAGGGGGAAGG - Intergenic
1178604709 21:34025675-34025697 CCGAGGAAAGCCAAGGAAGGAGG + Intergenic
1179403307 21:41104374-41104396 AGCAGGAAAGCTAATGAGGAGGG - Intergenic
1179432057 21:41328584-41328606 CTTTGGAAGGCTAAGGCGGATGG - Intronic
1179579768 21:42334308-42334330 CTTAGGGAGGCTAAGGTGGATGG - Intergenic
1179651398 21:42811506-42811528 CTTTGGAAAGCTGAGGAGGGTGG - Intergenic
1180107371 21:45629033-45629055 CTGAGGCAAGAAAGGGAGGAAGG + Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181016408 22:20071624-20071646 CTGATGATAGCTGAGGAGCAGGG + Intergenic
1181774183 22:25147952-25147974 GGGAGGAAAGGAAAGGAGGAAGG - Intronic
1182214987 22:28708476-28708498 CAGAAGAAAGCCAAGCAGGAAGG + Intronic
1182325166 22:29507112-29507134 CTTTGGAAAGCTAAGGCGGGAGG - Exonic
1183536717 22:38406057-38406079 CTTAGGAAGGCCAAGGTGGACGG - Intergenic
1183718929 22:39550937-39550959 CAGAGAAACGCCAAGGAGGAAGG + Intergenic
1184504622 22:44893358-44893380 CTTAGGAAAGCGAATGAGGGAGG + Intronic
1184676998 22:46048948-46048970 CTGTGGAAAGCTGAGGTGGGTGG - Intergenic
1184769898 22:46590728-46590750 CTGAGGACAGCTAAGGACGATGG + Intronic
1185006753 22:48282543-48282565 CTTTGGGAAGCCAAGGAGGAGGG + Intergenic
950080195 3:10216460-10216482 AAGAGGAAGGCAAAGGAGGAGGG + Intronic
950340428 3:12239473-12239495 CTTGGGAAAGCCAAGGAGAAGGG - Intergenic
950355095 3:12401172-12401194 AGGAGGAAAGCGAAGGAGGTTGG - Intronic
950734873 3:14998766-14998788 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
951085589 3:18509011-18509033 GTGGGGAAAGCTAAAGAGGCTGG + Intergenic
951132730 3:19067792-19067814 CTTTGGAAAGCTAAGGTGGGAGG + Intergenic
951441314 3:22727060-22727082 CTGAGGAAATAAAAGGAGGGAGG - Intergenic
951680799 3:25292636-25292658 ATTAAGAAAGCTAAAGAGGAAGG - Intronic
952212868 3:31247119-31247141 CTGAGGGTAGCGGAGGAGGAAGG - Intergenic
952373230 3:32743228-32743250 CTTTGGGAAGCTAAGGCGGATGG - Intronic
953336015 3:42094613-42094635 CTTTGGAAAGCTAAGGTGGTAGG - Intronic
953606707 3:44417314-44417336 TTGAGCAAAGCTATGGAGGCTGG - Intergenic
953782719 3:45885818-45885840 CTCAGGGAAGCTGAGGTGGAAGG - Intronic
954807292 3:53228043-53228065 CTGAAGAAAGGTGAGGAGAAGGG - Exonic
955349821 3:58185121-58185143 CTGAGGAAGGCCAAGGATGCTGG - Intergenic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
956418591 3:69060877-69060899 CTCGTGAAAGCTAAGGGGGATGG - Intronic
956913133 3:73842195-73842217 CTGGGGGAGGCTAAGGAAGAAGG + Intergenic
957585023 3:82122032-82122054 CTGAGAAAAGCTGAGTAGGAAGG - Intergenic
958196618 3:90248915-90248937 CTTTGGAAGGCTGAGGAGGATGG - Intergenic
958999828 3:100950572-100950594 CTGAGGAAAAGTAAAGATGAAGG + Intronic
959182841 3:103004055-103004077 CTTTGGGAAGCGAAGGAGGAAGG - Intergenic
959526813 3:107386785-107386807 CTGAGAAAAACTGAGGTGGAAGG - Intergenic
959579321 3:107967945-107967967 CTGTGGGAAGCTAAGGCGGGAGG - Intergenic
959841389 3:110980583-110980605 CTGAAGATAGGTTAGGAGGATGG + Intergenic
960429132 3:117547367-117547389 CTGAGAAAAGCTTGGCAGGAGGG - Intergenic
960723793 3:120650000-120650022 ATGAGGAAAGACAAGGAGAAAGG + Intronic
960916619 3:122701708-122701730 CTGAAGAAAGATAAGGACCAAGG + Intronic
961064217 3:123860885-123860907 CTTTGGAAAGCTGAGGAGGGAGG + Intronic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
962089830 3:132231307-132231329 CTGGGGAAAGCGAAGGAATAGGG - Intronic
962354358 3:134681069-134681091 CTGGGGAGAGCCAAGGGGGAGGG + Intronic
962605715 3:137031340-137031362 CTTTGGAAGGCTAAGGTGGAAGG - Intergenic
963107498 3:141659739-141659761 CTGGGGAATGTTAAGGAGAAAGG - Intergenic
963261300 3:143193815-143193837 ATGATCAAAGCTGAGGAGGAGGG - Intergenic
963646734 3:147924048-147924070 CAGAGGAAAAGTAAGGAGTATGG - Intergenic
964763166 3:160153407-160153429 CTGAGGGAGGCCAAGAAGGATGG - Intergenic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965015878 3:163156023-163156045 CTGAGTATTGCTAAGGAAGAAGG + Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965542943 3:169888766-169888788 CTTAGGAATACAAAGGAGGATGG - Intergenic
965757701 3:172041316-172041338 CTAGGGAAAGCTAAGGGAGAGGG + Intronic
965957819 3:174391631-174391653 CTTTGGGAAGCTGAGGAGGATGG - Intergenic
966860038 3:184226111-184226133 CTTTGGGAAGCCAAGGAGGAAGG + Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
968267727 3:197375635-197375657 CTGACAACAGCTAAAGAGGAAGG + Intergenic
968329180 3:197850096-197850118 CTGAGGAAATCTAAACAGGATGG + Intronic
969502825 4:7563990-7564012 ATGTGGAAAGCAAAGGAGGAAGG - Intronic
969659360 4:8517595-8517617 CTCAGGACAGCTAAGCTGGAAGG - Intergenic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
970715829 4:18921540-18921562 CTGAAGAAAGTTAAAAAGGAAGG - Intergenic
973980055 4:56300534-56300556 AGAAGGAAAGGTAAGGAGGAGGG - Intronic
974878543 4:67725962-67725984 CTAAGGAAAGCTAAGGAGCTGGG + Intergenic
975771705 4:77731254-77731276 TTGAGGAAAGTTAAGGGAGATGG - Intronic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
978203884 4:106056346-106056368 CTATGGGAGGCTAAGGAGGAAGG - Intronic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
978848058 4:113298335-113298357 CTGATGGAAGCTATGGATGAGGG + Intronic
978880807 4:113700497-113700519 CTATTTAAAGCTAAGGAGGAGGG - Intronic
979419146 4:120481751-120481773 CTGAAAAAAGCTAAGAAGAAAGG - Intergenic
979558771 4:122079034-122079056 CTGGGGGAAGCTGAGGAGGGAGG - Intergenic
983560587 4:169097515-169097537 CACAGGAAGGCTAAGGAGCATGG - Intronic
984502402 4:180572685-180572707 CTTAGGGAAGCTAAGGCGGGAGG - Intergenic
1202771125 4_GL000008v2_random:208686-208708 CTGAGGAAAGCCATGGAAAACGG + Intergenic
985711480 5:1432057-1432079 CAGAGGAAGGGTAGGGAGGAAGG + Intronic
986322236 5:6641362-6641384 CTGAGTAAAGCTAAAGGGAATGG + Intronic
986513256 5:8531225-8531247 CTGTGGACAGCCAAGGTGGAAGG - Intergenic
988198816 5:28044834-28044856 CTGAGGAAAGTTATGGAAGGGGG + Intergenic
988427775 5:31083596-31083618 CAAAGGAAAGGAAAGGAGGAAGG + Intergenic
990579841 5:57157305-57157327 GTGAGGAAAGGTAAGGGGAAGGG + Intergenic
991709944 5:69398927-69398949 CTTTGGAAAGCTGAGGTGGAAGG + Intronic
992030957 5:72721095-72721117 CTGAGAAAGGCTGAGGAGGGAGG - Intergenic
992068396 5:73127986-73128008 CTTCGGGAAGCTGAGGAGGAAGG - Intronic
992706537 5:79400598-79400620 CTTTGGGAGGCTAAGGAGGATGG - Intronic
992713940 5:79490686-79490708 CTTTGGAAAGCCAAGGTGGAGGG + Intronic
992911364 5:81398906-81398928 CTGGGGAAAGCCAGGGAGGCAGG - Intergenic
993915966 5:93742511-93742533 GTGCAGAAAGCTAAGGAGGGAGG + Intronic
993929925 5:93925543-93925565 CTGAGTAAAACAAAGTAGGATGG + Intronic
995191815 5:109325874-109325896 CTGAAGGATGCTAAGAAGGAAGG + Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
997310681 5:132878457-132878479 CTGAGGACACCTATTGAGGAGGG + Exonic
997872373 5:137516956-137516978 CAGAGGCAAGTTCAGGAGGAGGG + Intronic
998357347 5:141551204-141551226 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
998845787 5:146308516-146308538 CTTAGGAAAGCTTTGAAGGATGG + Intronic
999360503 5:150982219-150982241 TAGAGAAAAGCTGAGGAGGAGGG - Intergenic
999914060 5:156238184-156238206 CTTTGGAAGGCTAAGGCGGAAGG - Intronic
1000495138 5:161972936-161972958 CTGAGGAAAAGAAAGGAGGCTGG + Intergenic
1001038648 5:168316126-168316148 CTGAGAAACGCTGAGGGGGAAGG - Intronic
1001149097 5:169211253-169211275 CTGAGTAATGCAGAGGAGGAGGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001541606 5:172543359-172543381 ATGAGGGATGCTGAGGAGGAAGG + Intergenic
1002312433 5:178323019-178323041 CGGAGGGAGGCTAAGCAGGACGG + Intronic
1002765423 6:234911-234933 CTGAGGGAAGCAAAGGTGCATGG + Intergenic
1002767185 6:252167-252189 CTGAACAATTCTAAGGAGGAAGG - Intergenic
1003576082 6:7296670-7296692 GTGAGGGAAGGAAAGGAGGAGGG + Intronic
1003576089 6:7296696-7296718 GTGAGGGAAGGAAAGGAGGAGGG + Intronic
1004630663 6:17418026-17418048 CTTTGGAATGCTAAGGCGGATGG + Intronic
1004715524 6:18213191-18213213 CTTTGGAAGGCTGAGGAGGATGG + Intronic
1005942381 6:30570376-30570398 CTGAAGAAAACAAAGGAGGGAGG + Intergenic
1006022371 6:31125018-31125040 AGGAGGAAAGCTGTGGAGGAGGG - Intronic
1006147887 6:31970135-31970157 CTGGGCAAAGCTAAGGAAGGCGG + Exonic
1006541044 6:34740016-34740038 TTTAGGGAAGCCAAGGAGGAAGG - Intergenic
1007555896 6:42766087-42766109 CTTTGGGAAGCTAAGGTGGATGG - Intronic
1007613761 6:43168081-43168103 CTTTGGGAAGCTAAGGTGGATGG - Intergenic
1007617388 6:43188194-43188216 CGAAGGAAAGCCATGGAGGAAGG + Intronic
1008928744 6:56914911-56914933 CTAAGGAAGGCAAATGAGGAAGG + Intronic
1009575797 6:65457406-65457428 CTTAGGAAGGCTGAGGTGGAAGG - Intronic
1010163037 6:72881130-72881152 CTTAGGAAAGCCATAGAGGAAGG + Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011647252 6:89471656-89471678 CTGAGCAAAGTTAAGGAGAAAGG + Intronic
1011712505 6:90069004-90069026 CAGAGGGAAGCAAAGAAGGAAGG - Intronic
1012311135 6:97725129-97725151 GTTAGGAAAGCTAGGGAGGAGGG + Intergenic
1012575305 6:100789090-100789112 GGGAGGAAAGGAAAGGAGGAAGG + Intronic
1012813103 6:103985895-103985917 CTGAGGAAAGTTAAGCAGGAGGG - Intergenic
1013189586 6:107790824-107790846 CTTTGGAAGGCTAAGGCGGACGG + Intronic
1014402701 6:121010772-121010794 CTGGTGAAAGCTAAAGAAGAGGG - Intergenic
1014688422 6:124532252-124532274 CTGAAGCAAGCTAGGGAGGAAGG + Intronic
1016389336 6:143559372-143559394 CTGAGGAAATATCAGGAGAAAGG + Intronic
1016615500 6:146043052-146043074 CTTTGGAAAGCTAAGGTGGGAGG + Intronic
1017117733 6:150995055-150995077 CTGAGGACATCTCAAGAGGAGGG + Intronic
1017538196 6:155371259-155371281 CACAGGAAGGGTAAGGAGGAAGG - Intergenic
1017872595 6:158499774-158499796 CAGAGCCAAGCTGAGGAGGAGGG - Intronic
1019601170 7:1884511-1884533 CTGAGGGAAGGTCAGCAGGACGG - Intronic
1020314469 7:6895184-6895206 AGGAAGGAAGCTAAGGAGGAAGG + Intergenic
1020897080 7:13953564-13953586 CTGAGGAATGCTACGGCAGATGG + Intronic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1022410185 7:30134461-30134483 CTGAGAAAATCTAAGGAAAAGGG - Intergenic
1023218629 7:37894474-37894496 CTGAAGATAGTTAAGGAGGCTGG + Exonic
1023396886 7:39759701-39759723 CTGAGGAAAGCCAGGAAGGATGG - Intergenic
1024720540 7:52132707-52132729 CTGACAGAAGCAAAGGAGGAAGG - Intergenic
1025198862 7:56949904-56949926 ATGAGGAAAGCGGAGGAGGGAGG - Intergenic
1025673084 7:63627029-63627051 ATGAGGAAAGCGGAGGAGGGAGG + Intergenic
1025847494 7:65213640-65213662 CTCAGGAAAGGAAAGGAGAAGGG + Intergenic
1025897742 7:65719530-65719552 CTCAGGAAAGGAAAGGAGAAGGG + Intergenic
1025925815 7:65959585-65959607 CACAGGAAAGCTAAAAAGGAGGG + Intergenic
1026688497 7:72532983-72533005 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026723731 7:72854874-72854896 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026965032 7:74434084-74434106 CTGAGGCTGGCTGAGGAGGAAGG + Intergenic
1027146711 7:75700646-75700668 CTGAGGAAAACCAACGAGAAGGG + Intronic
1027835340 7:83234673-83234695 CTGATGAAATCTAAGTAGAATGG + Intergenic
1028468976 7:91184434-91184456 CTGAGGAGGACTAAGGAGGCAGG + Intronic
1028816495 7:95152191-95152213 CTGTGGAAAGCCAAGGCGGGTGG - Intronic
1028827490 7:95290201-95290223 AAGAGAAAAGCTAAGGAGAAAGG + Exonic
1029412834 7:100426826-100426848 GGGAGGAAAGGGAAGGAGGAGGG - Intronic
1032097439 7:128946616-128946638 CTGCGGAAACCTAAGGCCGATGG - Intronic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032529279 7:132606757-132606779 CTGAGAAAAATTAGGGAGGAGGG + Intronic
1032741466 7:134743448-134743470 CTGAGCAAATCTAAGGGGGGTGG + Intergenic
1033080368 7:138290946-138290968 CTTTGGGAGGCTAAGGAGGATGG - Intergenic
1033085216 7:138335164-138335186 CTTGGGGAAGCTGAGGAGGAAGG - Intergenic
1033496845 7:141907608-141907630 ATGAGGAAATCCAAGAAGGATGG - Intergenic
1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG + Intergenic
1034011937 7:147538406-147538428 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1034835021 7:154344078-154344100 CTGATGAAAGGTAGGCAGGAGGG + Intronic
1035483590 7:159205465-159205487 CCAAGGAAAGCAAAGGAGGAAGG + Intergenic
1037793210 8:21966555-21966577 TTTAGGAAAGCTTAGGAGGCTGG + Intronic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1038155840 8:24989521-24989543 CTCAGTAAAGCTGGGGAGGAGGG - Intergenic
1039545761 8:38410052-38410074 CTGAGGAGAGCCAGGGAAGAAGG - Intergenic
1040350001 8:46555550-46555572 CTTTGGGAAGCTAAGGTGGAAGG + Intergenic
1040367786 8:46736701-46736723 CTTCGGGAAGCTAAGGAGGGAGG - Intergenic
1040484241 8:47855009-47855031 CAGAGGCAAGCTGAGGCGGAGGG + Intronic
1040746751 8:50652551-50652573 CTTTGGGAAGCAAAGGAGGATGG + Intronic
1041178788 8:55226593-55226615 CTCAGGAGTTCTAAGGAGGAAGG - Intronic
1041512401 8:58666434-58666456 CTGAGGAGAAATAAGGAGGAAGG + Intergenic
1042134727 8:65622144-65622166 CTTTGGAAAGCCAAGGTGGAAGG + Intronic
1042240576 8:66660059-66660081 CTGATGAAAGCTAAAAAGTATGG + Intronic
1043389051 8:79773625-79773647 CTCAGGAAGGCTCAGGAAGAAGG - Intergenic
1044420979 8:91995542-91995564 CTTTGGAAGGCTCAGGAGGAAGG + Intronic
1044527096 8:93264515-93264537 CTTTGGGAAGCCAAGGAGGACGG + Intergenic
1044659788 8:94583719-94583741 CTTTGGAAAGCTGAGAAGGAAGG + Intergenic
1045431095 8:102115762-102115784 CAGAGGAAGGCTAAGGATGCTGG - Intronic
1045551647 8:103178399-103178421 CTGGGGAAATCTAAATAGGACGG + Intronic
1046731563 8:117731769-117731791 CTGAGAAAGGCTCAGGAGCAGGG + Intergenic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1047629494 8:126691729-126691751 CTGAAGAAAGGTAGGGAGCAAGG - Intergenic
1047726297 8:127686912-127686934 CTGAGGAAATTTAATCAGGATGG + Intergenic
1048889632 8:138936053-138936075 CTGAGGAAGGATGTGGAGGAGGG + Intergenic
1049031722 8:140043086-140043108 CTGATGAAAGTTAAGGAGCTAGG + Intronic
1049439698 8:142603690-142603712 CTTAGGGAAGCTGAGGTGGAAGG - Intergenic
1050165454 9:2760397-2760419 CTTTGGGAAGCTAAGGTGGAAGG + Intronic
1050291586 9:4160998-4161020 CTTAAGAAGGCTAAGGTGGAAGG + Intronic
1051241253 9:15058746-15058768 CTTTGGTAGGCTAAGGAGGACGG + Intergenic
1051580669 9:18670373-18670395 CAGAGGTAACCTAAGCAGGATGG + Intronic
1051797492 9:20889137-20889159 CTGCTGAAAGCTAAGGACAAGGG - Intronic
1051819504 9:21148539-21148561 TTGAAGAAAGCTAGAGAGGAGGG - Intergenic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052352661 9:27473314-27473336 CTGAGGGAGGCAAAGGGGGAGGG + Intronic
1052549559 9:29930630-29930652 CTGTGGGAGGCTAAGGAGGGTGG + Intergenic
1052630088 9:31026390-31026412 ATTCGGAAAGCTAAGGTGGAAGG + Intergenic
1052850177 9:33373425-33373447 GTGAGGAAGGCTAATGAGGAAGG - Intergenic
1052976315 9:34413172-34413194 GTGAGGAGAGGAAAGGAGGAAGG + Intronic
1053198155 9:36136031-36136053 CTGAGGAAAGGCAGGGAGGTGGG + Intergenic
1053241923 9:36502828-36502850 CTTTGGAAAGCTGAGGAGGCGGG + Intergenic
1055110280 9:72552394-72552416 CTGTGGAAAACTAAGAGGGAGGG + Intronic
1055114030 9:72588030-72588052 CTTTGGAAGGCTGAGGAGGATGG - Intronic
1055420584 9:76136977-76136999 CTGAAGAAATGTAAGGAGGTTGG - Intronic
1057249445 9:93488392-93488414 ATGTGGAAAGCCAAGCAGGAGGG - Intronic
1058552475 9:106129538-106129560 ATGAGGACAGCTAAGAATGAGGG + Intergenic
1059005708 9:110399775-110399797 CTTTGGAAAGCCAAGGAGGGTGG - Intronic
1059309771 9:113380250-113380272 CTTTGGAAGGCTAAGGTGGAAGG + Intergenic
1059397103 9:114042427-114042449 CTTTGGGAAGCTAAGGAGGGAGG + Intronic
1059530820 9:115033873-115033895 CTGAGGTTAACTAAGGAGCATGG + Intronic
1059867319 9:118530062-118530084 CTGTGAAAAGCATAGGAGGAGGG + Intergenic
1060181467 9:121537402-121537424 CTTTGGGAAGCCAAGGAGGAAGG - Intergenic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060543021 9:124444122-124444144 ATGATGAAAACTAAGGAAGAAGG + Intergenic
1060608187 9:124936692-124936714 CTTTGGGAAGCTAAGGCGGAAGG - Intronic
1061404522 9:130385987-130386009 CTGAGGAAACCGAGGCAGGAAGG - Intronic
1062201720 9:135306251-135306273 AGGAGGAAAGGAAAGGAGGAAGG - Intergenic
1062294018 9:135814116-135814138 GTGTGGAAATCTAAGCAGGAAGG + Intronic
1062721718 9:138047775-138047797 CTTAGGACAGCAAAGGAGGAGGG + Intronic
1185936215 X:4259336-4259358 CTGTGGAAAGCTAAGACAGAGGG - Intergenic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186312330 X:8334465-8334487 CTGAGGAAATCTTAACAGGATGG + Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186942744 X:14528893-14528915 CTGAAGAAAGCTCAGTTGGAAGG + Intergenic
1188109250 X:26177804-26177826 CTGAGAAAAGCAATGGAGAAAGG - Intergenic
1188109937 X:26185074-26185096 CTGAGAAAAGCAATGGAGAAAGG + Intergenic
1189186534 X:39060052-39060074 CTGAGGAAAGATAAGGATCAGGG - Intergenic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1191075481 X:56448796-56448818 CTGAAAAAATTTAAGGAGGAAGG - Intergenic
1191690543 X:63933868-63933890 ATGAGGAAAGCTGAGGAGGCCGG - Intergenic
1193141416 X:78031017-78031039 ATGAGGAAATCTAAGCAGTAGGG - Intronic
1194643892 X:96434699-96434721 CAGAGGAAAGATAATGATGAGGG + Intergenic
1195127764 X:101824944-101824966 CTGAGGCCAGCACAGGAGGAGGG - Intergenic
1195923547 X:110003955-110003977 CTGAGGCAGACGAAGGAGGACGG + Exonic
1196052551 X:111321021-111321043 CTGATGGAGGCTAGGGAGGAGGG + Intronic
1196409710 X:115402662-115402684 ATGAGTATAGCTAAGGAGAAGGG - Intergenic
1196505115 X:116433338-116433360 CTCAGGAAACTTATGGAGGAAGG + Intergenic
1197588033 X:128373805-128373827 CTGGAGTAAGCTGAGGAGGAAGG - Intergenic
1198175904 X:134154051-134154073 CTCTGGAAAGCTAAGGTGGGAGG + Intergenic
1198305134 X:135374226-135374248 CTGAAGGAAGGTTAGGAGGAAGG + Intergenic
1198730120 X:139719599-139719621 ATGAGGAAAGCCAAGTAGAATGG - Intergenic
1199785692 X:151102913-151102935 CTAAGGAAATGTAAGGAAGATGG + Intergenic
1199973175 X:152875576-152875598 TCAAGGAAAGCTAGGGAGGAGGG + Intergenic
1200110579 X:153738758-153738780 CTGAGGTAAGCTAAAGACCACGG + Intronic
1200749030 Y:6928406-6928428 CTGAGCAAAACTAAGGCAGAAGG - Intronic
1201364769 Y:13191672-13191694 CTTTGGGAGGCTAAGGAGGATGG + Intergenic