ID: 1115378789

View in Genome Browser
Species Human (GRCh38)
Location 14:32709666-32709688
Sequence GAAGGCTGTGGAATTCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115378789 Original CRISPR GAAGGCTGTGGAATTCCCTC TGG (reversed) Intronic
900873505 1:5324314-5324336 GAAGGCAGTGGACTTCTCTGTGG - Intergenic
904624924 1:31797028-31797050 GCAGGCTCTGGAGTTCCCACTGG + Intronic
906475124 1:46164410-46164432 GGAGGCTGTGGTAATGCCTCAGG - Intronic
907447266 1:54516561-54516583 GCAGGCTTTGGCCTTCCCTCAGG - Intergenic
907473812 1:54692187-54692209 GAAGGCTGTGCTTTTACCTCTGG - Intronic
909648724 1:77949168-77949190 GGATGCTGTGGCATTCCCTGGGG + Exonic
910674192 1:89800548-89800570 CAAGGCTGTAGAATACCATCAGG - Intronic
915699095 1:157773818-157773840 GGAGGATGTGGAACTCCCTGAGG - Intronic
922685296 1:227634125-227634147 CAAGGCAGTGGGTTTCCCTCTGG - Intronic
923407237 1:233674098-233674120 GATGCCTGCGGAATGCCCTCAGG + Intergenic
1063606698 10:7528761-7528783 GAAGGCTCTGGAAATGCCCCCGG + Intergenic
1063971510 10:11384465-11384487 GAAGCTTCTGGAAGTCCCTCAGG - Intergenic
1068737337 10:60429121-60429143 GCAGGCTCTGGAATTCCCTTGGG - Intronic
1070554489 10:77517276-77517298 TACTGCTGTGGAATTGCCTCTGG - Intronic
1071195406 10:83153523-83153545 GGAGGATGTGGAATTCTGTCGGG + Intergenic
1071493982 10:86155202-86155224 GAAGGCTGGGGAAGGCCCTCTGG + Intronic
1071869718 10:89780877-89780899 GAAGGCAGTGGGCTCCCCTCTGG + Intergenic
1072916193 10:99538667-99538689 GAGGGTTGTGGGATGCCCTCTGG + Intergenic
1075648048 10:124109375-124109397 GAAGGCTGTGGTTTGGCCTCAGG + Intergenic
1075930085 10:126288376-126288398 GGAGGATGTGGAATCCTCTCCGG - Intronic
1076180531 10:128403625-128403647 GAAGCCAGTGGAATTCCCAGGGG - Intergenic
1076483015 10:130797142-130797164 CCAGGTTGTGGAATTCCCTCAGG - Intergenic
1076628290 10:131834970-131834992 GGAGGCTGTGGAGTTTCCTGTGG - Intergenic
1077144729 11:1039853-1039875 GAAGGCTCTGGAACTGACTCGGG + Intergenic
1077505451 11:2928039-2928061 GAGGGCTGAGGGATTCCTTCTGG + Intergenic
1078416339 11:11169254-11169276 GAAGTCTGTAGAATTTCCTGAGG - Intergenic
1086806606 11:91251514-91251536 GAAGACTGTGGCAATTCCTCAGG - Intergenic
1087799666 11:102489735-102489757 GAAGGCTTTGGAATTCTGTTGGG + Intronic
1089137127 11:116258495-116258517 AAAGGCTGTAGAAATCCGTCGGG + Intergenic
1090061872 11:123471186-123471208 GAAGGCTGTAAACTTCTCTCAGG + Intergenic
1091408535 12:224039-224061 CAAGGATGAGGACTTCCCTCCGG + Exonic
1091748940 12:3010722-3010744 GGAGGCTCTGGAAGTTCCTCAGG + Intronic
1092405068 12:8215736-8215758 CAGGGCTGTTGAATTCCCACAGG + Intergenic
1093392096 12:18635624-18635646 GAAGGCTTTGCAAGTCCCTATGG - Intronic
1101417053 12:104517498-104517520 GATGCATGTGGAATTCCCTGGGG + Intronic
1105909903 13:24853891-24853913 GAAGTCTCTGGAAGTCCCCCTGG + Exonic
1106131757 13:26946532-26946554 GAAGGGTATGGAATTTCCTTGGG + Intergenic
1106645263 13:31627412-31627434 GAAGGTTGAGGAAGTCTCTCTGG + Intergenic
1110541836 13:76714557-76714579 GAAGGCTGTGGAATTCAGTAAGG - Intergenic
1111978528 13:94993178-94993200 GGAGGCTGTGAAATCCCCTAGGG - Intergenic
1112179562 13:97064612-97064634 GAAGGCTGTGATATGCCTTCTGG + Intergenic
1112856971 13:103784652-103784674 GAAGGATGTTGAATTCATTCTGG - Intergenic
1113764283 13:112871103-112871125 GAAGCCTGGGGGCTTCCCTCGGG - Intronic
1115236033 14:31209170-31209192 GAAGGAAGTGGCATTCCCTCTGG + Intergenic
1115378789 14:32709666-32709688 GAAGGCTGTGGAATTCCCTCTGG - Intronic
1115496650 14:34011552-34011574 GAAGGCTAGAGAATTCCCTGTGG + Intronic
1116481094 14:45392252-45392274 CAGGGCAGTGGATTTCCCTCTGG - Intergenic
1117433814 14:55697473-55697495 GACGGCTGTGGAATTTGCACTGG - Intronic
1119855555 14:77897894-77897916 GTTGGCTGTGGAATTCCCAGGGG + Intronic
1120882606 14:89425961-89425983 GAAGGCTGTGGTATGCCTTATGG - Intronic
1120980911 14:90288200-90288222 GAACGGTCTGGAATTACCTCTGG + Exonic
1121291277 14:92777693-92777715 GAAAACTGTGGGCTTCCCTCGGG + Intergenic
1125679743 15:41523244-41523266 GCAGCCTGTGGGATTCCCTTAGG - Exonic
1125800865 15:42445645-42445667 GAAAGATGATGAATTCCCTCAGG - Intronic
1125846291 15:42857620-42857642 ATAGGCTGTAGAATTTCCTCAGG - Intronic
1128787839 15:70411190-70411212 GAGGGCTGTGGCATTTTCTCTGG + Intergenic
1129071093 15:72952261-72952283 GAAGGAGGTGGTGTTCCCTCGGG + Intergenic
1129858654 15:78843226-78843248 GAAGGCACTGGAATTCTCTATGG + Intronic
1131959398 15:97773041-97773063 GAGGGCAGTGGGCTTCCCTCTGG + Intergenic
1132375296 15:101324758-101324780 GAAGGCTGGGAAATTCTCCCTGG + Intronic
1135405746 16:22196404-22196426 GGAGGCTGTGGAATGCCGGCTGG - Intergenic
1137227116 16:46524092-46524114 CAAGGCTGTGGGCTCCCCTCTGG + Intergenic
1138441435 16:57037339-57037361 GAAGCCCTTGGAATTCCTTCTGG + Intronic
1142057110 16:88004918-88004940 GAAGGCTGTGCAGTGGCCTCTGG + Intronic
1142151029 16:88512629-88512651 GAAGCATGTGGAATCCCATCCGG - Intronic
1142808132 17:2382296-2382318 AAAAGCTGTGGGATCCCCTCTGG - Intergenic
1143348178 17:6265823-6265845 GAAGGCTGTGGTGATCCTTCTGG + Intergenic
1143758568 17:9084586-9084608 GAAGGCTGTGGAATGTCCAGAGG - Intronic
1146597202 17:34179806-34179828 GAAGGGTGAGGATTTCCCTAGGG + Intergenic
1147125134 17:38362336-38362358 GAAGGCTGTAGAATCTCCTTTGG + Intronic
1147648789 17:42050405-42050427 GAGGGCTGAGGAACTTCCTCTGG + Intronic
1148215853 17:45833714-45833736 GAAGGCTGTGAAAGCCACTCTGG + Exonic
1149436972 17:56641260-56641282 AAATGCTGTGGAATGCCCCCAGG - Intergenic
1150004849 17:61463218-61463240 GAAGGCAATGGAACTCCCTGAGG + Intronic
1155065101 18:22262381-22262403 GAAGGATGTAGAATTCAGTCGGG - Intergenic
1156301747 18:35842297-35842319 GAGGCATGTGGAATTCCTTCTGG + Intergenic
1157548865 18:48566770-48566792 AAAGGCTGTGGAAACCCCTTTGG + Intronic
1162188660 19:8927417-8927439 GGAGGATGTGGAAATCCCTGGGG + Exonic
1164638743 19:29810444-29810466 GAAGGCTCTGGAATGCTCCCAGG - Intergenic
1167083157 19:47291021-47291043 CAAGGCTGTGGACTTCCCTCTGG - Intronic
1167792528 19:51690621-51690643 GTAGGCTCTGGACTTCCCCCAGG - Intergenic
925031624 2:654234-654256 GAGGGCTGGGGAATTGCCTGTGG + Intergenic
926744520 2:16139754-16139776 GATGGATGTTGAGTTCCCTCTGG + Intergenic
928081922 2:28319497-28319519 GAAGTCTGTGGGGTTCCCTCAGG + Intronic
931828021 2:66021556-66021578 AAAGCCTGTGAAATTCCATCTGG + Intergenic
932842219 2:75094306-75094328 GTAGGCTATGGAATTTCGTCGGG + Intronic
935107914 2:100062614-100062636 GAAGGCAATGGAATTGTCTCAGG + Intronic
935329478 2:101966110-101966132 TTTGGCTGTGGAATTCCCTTTGG - Intergenic
935636376 2:105252366-105252388 CAAGGCCTTGGAATTCTCTCTGG + Intergenic
936097053 2:109538386-109538408 TAAGGCTGTGGATGTCTCTCAGG + Intergenic
939000463 2:136728283-136728305 AAAGCCTGTGGAATTCCCTATGG + Intergenic
941681403 2:168403495-168403517 GAAGGCTGTTGCCTTGCCTCTGG + Intergenic
943266730 2:185740751-185740773 GAAGGCTGGAGAGTTCCCTGTGG + Intronic
944593071 2:201236507-201236529 AAACACTGTGGAATTCACTCTGG - Intronic
944973691 2:205023387-205023409 GAAGGCTGAGGAGTTGCCTCTGG + Intronic
946938712 2:224748877-224748899 GCAGGATGGGGAATGCCCTCAGG + Intergenic
947716717 2:232343577-232343599 GAAGCATGTGGAATTCCTTGTGG + Intronic
1169190025 20:3652829-3652851 GAAGGGTGTGGTCTTCCCACTGG + Intergenic
1173633314 20:44532556-44532578 GAAAACTGTGGAGTTCCCTCAGG - Intronic
1177198628 21:17929746-17929768 AAAGCCTGTGGAATTCCATGTGG - Intronic
1184739219 22:46417503-46417525 GAAGGGTGCGGTATTCCCCCAGG + Intronic
950847350 3:16027724-16027746 GAAGGCTTTGGCTTTACCTCTGG - Intergenic
951621164 3:24603475-24603497 GAAAGCTGAGGAATGCCCTGAGG - Intergenic
958682790 3:97353044-97353066 CAAGGCAGTGGGATTCCTTCTGG - Intronic
961069293 3:123906659-123906681 GAAAGCTGTAGAATTTTCTCTGG - Intronic
961460953 3:127050148-127050170 GAAGGCTGAGAAATGACCTCTGG - Intergenic
962454556 3:135553122-135553144 GGATGCTCTGGACTTCCCTCTGG + Intergenic
964323591 3:155523412-155523434 GAAGGGCTTGGAAATCCCTCTGG + Intronic
964952747 3:162316961-162316983 CATGGCAGTGGAACTCCCTCTGG + Intergenic
965967180 3:174507220-174507242 GAAGGCTGTGCAATTCATTAAGG - Intronic
965988301 3:174783643-174783665 GAAAGCTGTGGCACTCACTCAGG - Intronic
968975372 4:3819665-3819687 GAAGGCTGCAGAATCCCCTTCGG + Intergenic
969540477 4:7785486-7785508 AAATGCTGTGAAATCCCCTCAGG - Intronic
969761054 4:9182259-9182281 CATGGCTGTTGAATTCCCACAGG - Intergenic
969935168 4:10673282-10673304 GAAAGCTGTGTAGATCCCTCTGG - Intronic
972885165 4:43476585-43476607 CAAGGCTGTGGGTTTCCTTCTGG + Intergenic
973348572 4:49083168-49083190 TAAGGCAGTGGGCTTCCCTCTGG - Intergenic
974711481 4:65602130-65602152 GAAGGCTGTTGCAGTCCCGCAGG + Exonic
974909997 4:68106239-68106261 GATGGCAGTGGGATTCCCTTTGG + Intronic
980133570 4:128839276-128839298 GAAGGCAGAGCAGTTCCCTCGGG + Intronic
980442980 4:132871442-132871464 CAAGGCAGTGGACTCCCCTCTGG - Intergenic
980873360 4:138635469-138635491 GAGGGCACTGGAATTTCCTCTGG - Intergenic
982326321 4:154132610-154132632 GATGGCTGTGGCATTTCCTTTGG + Intergenic
982669071 4:158298671-158298693 GAAGGCAGCTGAATTCTCTCAGG + Intergenic
983437737 4:167736680-167736702 GAAGTCTGTGAAATTCCATTTGG + Intergenic
984773766 4:183462385-183462407 GAAAGCTGTAGAATAGCCTCAGG - Intergenic
985754727 5:1706826-1706848 CTAGGCTGTGGAAGACCCTCTGG + Intergenic
986240602 5:5956378-5956400 GAAAGCTGTGGCATTTCCTGAGG - Intergenic
986256198 5:6103020-6103042 GTAGGCTTTGGAAATTCCTCAGG + Intergenic
986666464 5:10108806-10108828 CAGGGCTGAGGAATTCCTTCAGG - Intergenic
986777782 5:11034379-11034401 GATTGTTGTGGAATTCCCTAAGG - Intronic
992291400 5:75283516-75283538 CAGGGCTGTGGACTACCCTCTGG - Intergenic
993669945 5:90747916-90747938 AAAGGCTCTCTAATTCCCTCAGG - Intronic
998104936 5:139462480-139462502 AAAGGCTCTGGAATTTCCCCTGG + Intronic
1003115956 6:3284089-3284111 GATGGGTATGCAATTCCCTCTGG + Intronic
1003159811 6:3625267-3625289 TGAAGCTGTGGAATTCCCTTGGG - Intergenic
1008943207 6:57069983-57070005 GAAGGCAGCTGAATTCTCTCAGG + Intergenic
1011340999 6:86313988-86314010 CAGAGCTGTGGAATCCCCTCTGG - Intergenic
1015389186 6:132662116-132662138 GAAGGATTTGGAAACCCCTCAGG + Intergenic
1015637455 6:135291625-135291647 GAAGTCTGTGGTATTCTCTGTGG + Intronic
1019265538 7:115422-115444 GAAGACTGTGGTCTTCCCTGAGG + Intergenic
1019444031 7:1061632-1061654 GAAGGCTTTGGGAATCTCTCAGG - Intronic
1020505806 7:8986513-8986535 GAACACTGTGAAATTGCCTCAGG - Intergenic
1021245254 7:18253767-18253789 GAAGGCTGTGGAGTCCCCAGTGG + Intronic
1022540680 7:31132951-31132973 GAAGTCTCTGGATTTCCCTTTGG - Intergenic
1023103261 7:36739976-36739998 GATGGCTGTGGAAATCTCACTGG + Intergenic
1024410868 7:49039476-49039498 CAGGGCAGTGGACTTCCCTCTGG - Intergenic
1024418401 7:49134897-49134919 GAAGGGTGAGAATTTCCCTCTGG - Intergenic
1024845793 7:53640865-53640887 GGAGGCTGTGAAATGTCCTCTGG + Intergenic
1027715000 7:81659009-81659031 GAGGCCTGTGACATTCCCTCAGG + Intergenic
1029235471 7:99113023-99113045 GAAGTCTGTGGAATACCATCTGG + Intronic
1029469680 7:100746443-100746465 GGAGGCTGTGGACTTGTCTCTGG - Intronic
1029561905 7:101308580-101308602 GGGGGCTGTGGAAGTCCCTGGGG - Intergenic
1032353112 7:131184486-131184508 GAAGGCTTTGGAAGTCCCCATGG - Intronic
1034170687 7:149060811-149060833 GAATTCTGTGGAATTCACTTTGG - Intergenic
1034318855 7:150160896-150160918 GAAGGCAGAGAAATTACCTCTGG + Intergenic
1034928641 7:155143201-155143223 TAAGGCTGTGGAACGCCTTCAGG - Intergenic
1035551866 8:534514-534536 GAAAGCTGTGGCACTCCCTACGG - Intronic
1036271157 8:7304090-7304112 CATGGCTGTTGAATTCCCACAGG - Intergenic
1036350192 8:8006253-8006275 CATGGCTGTTGAATTCCCACAGG + Intergenic
1036845462 8:12166685-12166707 CATGGCTGTTGAATTCCCACAGG + Intergenic
1036866828 8:12409006-12409028 CATGGCTGTTGAATTCCCACAGG + Intergenic
1037849387 8:22314280-22314302 TCAGGCTGTGGAATTCTCTGGGG - Intronic
1042223349 8:66494722-66494744 GCAGGAGTTGGAATTCCCTCTGG + Intronic
1045740789 8:105357216-105357238 GAAGGATGTGGAACTTCCACTGG - Intronic
1045760395 8:105599409-105599431 GAAGGCTGTGGTGTTCCCTAAGG + Intronic
1046268165 8:111858707-111858729 CAGGGCAGTGGGATTCCCTCTGG + Intergenic
1047724015 8:127669023-127669045 GAAGGCTGTGGCTTCCCCTCAGG - Intergenic
1049445542 8:142628971-142628993 GGAGGCTGTGGAATGGACTCAGG - Intergenic
1051386525 9:16515140-16515162 TAATGATGTTGAATTCCCTCTGG - Intronic
1054863790 9:69979250-69979272 AATGGCTATGGAATTCACTCTGG - Intergenic
1055051417 9:71985012-71985034 ACAGGCTGTGGAATTCCTTTCGG - Intronic
1056497006 9:87167194-87167216 GAAGGCTGTGGTGTGCCTTCAGG - Intergenic
1058337848 9:103855129-103855151 GGAGTCTTAGGAATTCCCTCAGG + Intergenic
1059403768 9:114087281-114087303 GGATCCTTTGGAATTCCCTCAGG + Intronic
1061842280 9:133366070-133366092 GAAGTCTGTGGAAATGCCTTTGG - Intronic
1186843540 X:13508857-13508879 GCAGGTAGTGGAATTACCTCCGG - Intergenic
1189308337 X:40003973-40003995 GAAGCCTTTGAAAGTCCCTCGGG + Intergenic
1191608370 X:63085520-63085542 GAAGGCTGTTCATTTGCCTCAGG + Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1194203444 X:90983165-90983187 GCAGGCTGGGGTATTGCCTCAGG + Intergenic
1196197577 X:112852064-112852086 TAAAGCTGGGGAACTCCCTCAGG - Intergenic
1198541450 X:137644319-137644341 AAGGGCTGTGCATTTCCCTCAGG + Intergenic
1198938944 X:141931696-141931718 CAAGGCTGTGGATTCCCTTCTGG + Intergenic
1198948128 X:142038460-142038482 GAACCTTGTGGAGTTCCCTCTGG + Intergenic
1199681833 X:150230095-150230117 GATGGCTGTGGAAGGCCCTGGGG - Intergenic
1200935061 Y:8731143-8731165 GAGGGCTGTGTGATTCCTTCAGG - Intergenic