ID: 1115385276

View in Genome Browser
Species Human (GRCh38)
Location 14:32789447-32789469
Sequence CCACACCTGTAGAAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 1, 2: 28, 3: 82, 4: 290}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115385276_1115385290 29 Left 1115385276 14:32789447-32789469 CCAGCCACCTTCTACAGGTGTGG 0: 1
1: 1
2: 28
3: 82
4: 290
Right 1115385290 14:32789499-32789521 GGAACGGAGCTTCCAGAGGAAGG 0: 2
1: 19
2: 484
3: 1611
4: 1674
1115385276_1115385289 25 Left 1115385276 14:32789447-32789469 CCAGCCACCTTCTACAGGTGTGG 0: 1
1: 1
2: 28
3: 82
4: 290
Right 1115385289 14:32789495-32789517 TACTGGAACGGAGCTTCCAGAGG 0: 1
1: 0
2: 2
3: 91
4: 783
1115385276_1115385286 13 Left 1115385276 14:32789447-32789469 CCAGCCACCTTCTACAGGTGTGG 0: 1
1: 1
2: 28
3: 82
4: 290
Right 1115385286 14:32789483-32789505 AGGTCAGTACCCTACTGGAACGG 0: 1
1: 0
2: 6
3: 30
4: 120
1115385276_1115385285 8 Left 1115385276 14:32789447-32789469 CCAGCCACCTTCTACAGGTGTGG 0: 1
1: 1
2: 28
3: 82
4: 290
Right 1115385285 14:32789478-32789500 GCAACAGGTCAGTACCCTACTGG 0: 1
1: 4
2: 31
3: 54
4: 179
1115385276_1115385283 -7 Left 1115385276 14:32789447-32789469 CCAGCCACCTTCTACAGGTGTGG 0: 1
1: 1
2: 28
3: 82
4: 290
Right 1115385283 14:32789463-32789485 GGTGTGGTTGGGCCGGCAACAGG 0: 1
1: 1
2: 8
3: 41
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115385276 Original CRISPR CCACACCTGTAGAAGGTGGC TGG (reversed) Intronic
901287354 1:8091494-8091516 GCACATCTGTAGTAGGTGGGAGG - Intergenic
901511167 1:9718677-9718699 CACCAGCTGTAGAAGGTGCCGGG - Exonic
901627902 1:10634185-10634207 CCACACCACTGGAAGGAGGCAGG - Intergenic
901787480 1:11634326-11634348 CCAAACCTGGAGAGGGAGGCAGG + Intergenic
903445342 1:23419071-23419093 CCCCACCTGTAGTAGCTGGATGG + Exonic
903656339 1:24950815-24950837 GCAGACCTGTAGTAGGTGGAAGG + Intronic
905624481 1:39478733-39478755 CCATAAATCTAGAAGGTGGCAGG - Intronic
907623914 1:56010236-56010258 ATGCACCTGTAGGAGGTGGCTGG - Intergenic
908450794 1:64252473-64252495 ACACTCCTGTAGGAGGTGACTGG - Intronic
910151287 1:84150120-84150142 CCACACCTGTAGATGGAGCCTGG - Intronic
911836262 1:102622943-102622965 ATACACCTGTAGGAGGTAGCTGG + Intergenic
912893250 1:113557781-113557803 ACGTACCTGTAGGAGGTGGCTGG - Intronic
912964614 1:114226975-114226997 ACACACCAGTAGAAGCAGGCAGG + Intergenic
913410133 1:118542260-118542282 AGGCACCTGTAGGAGGTGGCTGG - Intergenic
915019724 1:152767608-152767630 CCACACTTGTAGAAGATGAGTGG + Intronic
915844858 1:159252525-159252547 AGGCACCTGTAGGAGGTGGCTGG - Intergenic
916183102 1:162105322-162105344 ACACACCTGTAGGAGGTGGCTGG + Intronic
916594695 1:166233032-166233054 ACACACTTGTAGGAGGTAGCTGG + Intergenic
916985869 1:170191227-170191249 ACACACCTGTAGGAGGTGGCTGG + Intergenic
917519622 1:175737113-175737135 CCACACAGCTAGTAGGTGGCAGG - Intronic
917585928 1:176426242-176426264 AAACACCTGTAGGAGGTGGCTGG + Intergenic
917597471 1:176543652-176543674 CCACACCTGGGGATGGTGGAAGG + Intronic
922120867 1:222666219-222666241 CCAGAACTGAAGATGGTGGCTGG + Exonic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
1065795898 10:29308200-29308222 CCAATCCTGAAGCAGGTGGCAGG - Intronic
1065821934 10:29533675-29533697 CTACCCCTGTAAAAGCTGGCAGG + Intronic
1065947067 10:30614466-30614488 CCAATCCTGAAGCAGGTGGCAGG + Intronic
1065964799 10:30762435-30762457 CCAGACCTTGAGAAGGTGGGAGG - Intergenic
1066509698 10:36082977-36082999 ACACGCCTGTAAGAGGTGGCTGG + Intergenic
1068612899 10:59080046-59080068 ACACACCAGTAGAAGGTTACAGG + Intergenic
1070018171 10:72556050-72556072 CCACACCTGGAAAAAGTAGCAGG + Intronic
1070054629 10:72923378-72923400 ACATACCTGTAGATGGTGGTTGG + Intronic
1070054679 10:72923656-72923678 ACACACCTATAGGAGGTGGCTGG + Intronic
1070247498 10:74745975-74745997 CCACAACTTTAAAAGGTAGCTGG - Intergenic
1072195694 10:93115882-93115904 CCAAACCCAAAGAAGGTGGCTGG + Intergenic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1074022066 10:109594296-109594318 ATGCACCTGTAGGAGGTGGCTGG - Intergenic
1075288622 10:121209082-121209104 CCACCCCTGAAGCAGGTGGAAGG + Intergenic
1075722324 10:124594431-124594453 CCACAGCTACAGAAGGGGGCTGG - Intronic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1076677253 10:132153528-132153550 CCTCTCCTGGAGAAGGTGTCAGG + Intronic
1077997549 11:7466977-7466999 GGCCACCTGCAGAAGGTGGCTGG - Exonic
1078033771 11:7781110-7781132 ATGCACCTGTAGGAGGTGGCTGG - Intergenic
1080292641 11:30688179-30688201 ACATGCCTGTAGGAGGTGGCTGG - Intergenic
1081177503 11:39946892-39946914 ACACATCTATAGGAGGTGGCTGG - Intergenic
1082184435 11:49162994-49163016 ACAGACCTGTAGGAGGTGGCTGG + Intronic
1084205246 11:67587491-67587513 GCACATCTTTACAAGGTGGCAGG - Intergenic
1085880616 11:80463164-80463186 ATGCACCTGTAGGAGGTGGCTGG - Intergenic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086610418 11:88748665-88748687 ATTCACCTGTAGGAGGTGGCTGG - Intronic
1086681914 11:89682374-89682396 ACAGACCTGTAGGAGGTGGCTGG - Intergenic
1087115555 11:94520757-94520779 CCAGGCCTGCAAAAGGTGGCAGG - Intergenic
1087606606 11:100384724-100384746 ACACACCTGTAGGAGGTGGCGGG - Intergenic
1088859873 11:113789722-113789744 CACCACCTGTAGAAGCTGGAGGG + Intergenic
1089605505 11:119639003-119639025 ACACACCTGGGAAAGGTGGCCGG - Intronic
1090567191 11:128007203-128007225 GCACACCTGTAAGAGGTGGCTGG - Intergenic
1093086118 12:14868616-14868638 ACATGCCTGTACAAGGTGGCTGG + Intronic
1093833137 12:23791144-23791166 CCACAGGTGTAGAAGATGACAGG + Intronic
1095835845 12:46638012-46638034 ACACATCTGTAGGAGGTAGCTGG - Intergenic
1098079241 12:66766358-66766380 CCACTCTTCTAGAAGGTGGCTGG + Intronic
1098128411 12:67323219-67323241 ACACACCTGTAGGAGGTGGCTGG - Intergenic
1098177688 12:67809964-67809986 CCACACCTGTAGAAGTAAGCAGG + Intergenic
1098201762 12:68063906-68063928 ACACTCCTGTATAAGGTGTCTGG + Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098658751 12:73067489-73067511 ACACACGTATAGTAGGTGGCTGG + Intergenic
1101186827 12:102289440-102289462 ACACTCCTGTATAAGGTGTCTGG + Intergenic
1101664090 12:106793852-106793874 CAACTCCTGGAGAAGGTGGGTGG + Intronic
1102560236 12:113756850-113756872 CCACACCACTAGAAAGTGGCAGG + Intergenic
1102772604 12:115491521-115491543 TCACACAGGTAGAAAGTGGCAGG + Intergenic
1103181305 12:118914270-118914292 TCACACATCTAGGAGGTGGCAGG + Intergenic
1105334985 13:19459408-19459430 ACATACCTGCAGGAGGTGGCTGG + Intronic
1105859938 13:24399982-24400004 ACATACCTGCAGGAGGTGGCTGG - Intergenic
1105978747 13:25497057-25497079 ACACACCTGCAGGAGGTGACTGG - Intronic
1106044128 13:26121849-26121871 TCAGACCTGTAGAAGGTAGGTGG + Intergenic
1106958697 13:34973215-34973237 ACATACCTGTAGGAGGTGGCTGG + Intronic
1107012005 13:35678925-35678947 CCACACAGGTGGTAGGTGGCAGG + Intergenic
1107053371 13:36076723-36076745 CCACATCAGTACTAGGTGGCGGG - Intronic
1107661317 13:42642757-42642779 ACACTCCTGTATAAGGTGTCTGG + Intergenic
1108479773 13:50856641-50856663 CTGTACCTGTAGGAGGTGGCTGG - Intergenic
1108629576 13:52268729-52268751 ATACACCTGTAGGAAGTGGCTGG + Intergenic
1108656482 13:52537759-52537781 ATACACCTGTAGGAAGTGGCTGG - Intergenic
1110788527 13:79561231-79561253 ACACACCTGTAGGACGTGGCTGG - Intergenic
1110867080 13:80407869-80407891 ACACACCTGTGGGAGGTGGCTGG + Intergenic
1111615723 13:90659298-90659320 ACACACCTGTAGGAGGTGACTGG - Intergenic
1112076220 13:95916124-95916146 ACACACCTATAGCAGGTGGCTGG - Intronic
1113144886 13:107197542-107197564 CCACACATGAAGAAGCAGGCAGG - Intronic
1113226874 13:108168916-108168938 ATACACCTGTAGGAGATGGCTGG - Intergenic
1113487217 13:110663091-110663113 CCACACCAGTAAGAGGTGGTGGG + Intronic
1115385276 14:32789447-32789469 CCACACCTGTAGAAGGTGGCTGG - Intronic
1115967877 14:38912343-38912365 ACACACCTGTAAGAGGTGGCTGG - Intergenic
1116493672 14:45536051-45536073 ACATGCCTGTAGGAGGTGGCTGG + Intergenic
1116932131 14:50701524-50701546 GCAGACCTGTAGGAGGTGGCTGG + Intergenic
1119487695 14:75002659-75002681 TCAGGCCTGTAGAGGGTGGCTGG - Intergenic
1120221749 14:81742082-81742104 CCACATGTGTAGAAAGTGGTAGG - Intergenic
1120637954 14:86974565-86974587 ACACACCCCTAGGAGGTGGCTGG - Intergenic
1121517619 14:94563300-94563322 CCATACATGTGGAAGGTGGTGGG + Intronic
1121634690 14:95445970-95445992 GCACTCCTGGAGCAGGTGGCAGG - Exonic
1122925599 14:104898069-104898091 CCACGGCTGTGGAAGGTGCCGGG + Intergenic
1125054508 15:35341784-35341806 ACACGCTTGTAGGAGGTGGCTGG + Intronic
1126225284 15:46262464-46262486 ATGCACCTGTAGGAGGTGGCTGG + Intergenic
1127188486 15:56505751-56505773 ACACATCTGTAGGATGTGGCTGG - Intergenic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127330972 15:57939953-57939975 ACATACCTATAGGAGGTGGCTGG + Intergenic
1132012475 15:98288162-98288184 CCATCCCTGGAGAAGGTAGCTGG + Intergenic
1132726429 16:1340905-1340927 AAACACCTGTGGAGGGTGGCTGG - Exonic
1132906643 16:2285916-2285938 CCACACCTGGGCAAGGTCGCCGG - Intronic
1137755608 16:50899712-50899734 CAAGACCTGGAGAAGGTGGGAGG - Intergenic
1139753825 16:69126897-69126919 ACACACCTGATGGAGGTGGCAGG + Intronic
1143023677 17:3929180-3929202 CCACAGCTGGAGGTGGTGGCTGG + Intronic
1143179041 17:4972986-4973008 CCACATCTGAGGAAGGGGGCGGG + Exonic
1144120896 17:12151196-12151218 ACGCTCCTGTAGAAGGTGTCTGG - Intergenic
1145009550 17:19360052-19360074 CAACACCTGCAGTAGGAGGCAGG - Intronic
1146729719 17:35183155-35183177 CCACACCAGGGGAAGGAGGCAGG - Intronic
1147461118 17:40569532-40569554 ACACACCTGTAGGAGATGGCCGG - Intergenic
1151804183 17:76395583-76395605 CCGCCCCTGTAAAAGGTGGGTGG + Intronic
1152326136 17:79638824-79638846 CCACTCATGTAGAAGGTGAAGGG - Intergenic
1152556631 17:81056340-81056362 CCACCCCTGGAGATGGGGGCTGG + Intronic
1152794901 17:82302010-82302032 CCACACCTGGGGGTGGTGGCTGG - Intergenic
1154181720 18:12144497-12144519 ACACACCTGTAGGAGGTGGCTGG + Intergenic
1154182184 18:12147087-12147109 ACACACCTGTAGGAGGTGGCTGG - Intergenic
1154454770 18:14510670-14510692 ACACACCTGTAGGATGTGACTGG + Intronic
1155091319 18:22514641-22514663 ACACACCTGTACATGGTGGCTGG + Intergenic
1155577073 18:27259587-27259609 ACACACCTGCAGGAGGTGGCTGG + Intergenic
1157287690 18:46388296-46388318 GCAAACCTGGAGAAGTTGGCAGG + Intronic
1159947075 18:74451765-74451787 CCTTACCTGTGGAAGCTGGCAGG - Intronic
1162488389 19:10976323-10976345 CCAGCCCTGTAGAAGCTGGATGG - Intronic
1164391048 19:27821826-27821848 ACACACCTGTAGGAGGTGACTGG + Intergenic
925912250 2:8581552-8581574 CAACCCCTGCAGGAGGTGGCAGG - Intergenic
926987374 2:18639481-18639503 ATGCACCTGTATAAGGTGGCTGG + Intergenic
928058311 2:28081809-28081831 CCACACCTAGAGAATGAGGCAGG - Intronic
929280431 2:40072336-40072358 ACACACCTGTAGGAGATGGCTGG + Intergenic
929388793 2:41443249-41443271 CCACAGCTGTTGAGGGTGGCGGG + Intergenic
929562323 2:42963577-42963599 CCACACCTGTACTGGGTGTCAGG + Intergenic
930229385 2:48827705-48827727 ATTCACCTGTAGGAGGTGGCTGG - Intergenic
930939576 2:56997877-56997899 ATACACCTGTAAGAGGTGGCTGG + Intergenic
931543324 2:63353687-63353709 AGACACCTGTAGGAGGTGGATGG - Intronic
932379664 2:71270421-71270443 ACATACCTGTAAGAGGTGGCTGG - Intergenic
934477194 2:94601672-94601694 CCACAGCTGGAGAAGGACGCTGG + Intronic
934479050 2:94618373-94618395 ACACTCCTGTATAAGGTGCCTGG + Intergenic
934623274 2:95829387-95829409 ACACACCTGTAGGAGGTAGCTGG + Intergenic
934810489 2:97272705-97272727 ACACACCTGTAGGAGGTGGCTGG - Intergenic
934827203 2:97435234-97435256 ACACACCTGTAGGAGGTGGCTGG + Intergenic
935834612 2:107037021-107037043 AGGCACCTGTAGGAGGTGGCCGG - Intergenic
935929897 2:108113120-108113142 ACACACCTGTAGGAGGTGACTGG + Intergenic
936254108 2:110894689-110894711 CCACCACTGCAGGAGGTGGCAGG - Intronic
936862103 2:117030415-117030437 ACACACCTGTAGAAGGTGGCTGG - Intergenic
937089422 2:119196110-119196132 TCACACCTGTTGCCGGTGGCTGG - Intergenic
937520950 2:122711926-122711948 ATACACCTGTAGAAGGTGGCTGG - Intergenic
938202014 2:129379871-129379893 CCTCACCTGTAGATGTTGGCTGG - Intergenic
938342642 2:130545908-130545930 CCACAGCTGTGGAAGGTGCCGGG - Intronic
938347191 2:130574814-130574836 CCACAGCTGTGGAAGGTGCTGGG + Intronic
938356949 2:130659570-130659592 ACACACCTGTAAGATGTGGCTGG - Intergenic
938477426 2:131628962-131628984 CCACACCTATAAGATGTGGCTGG - Intergenic
939398424 2:141660889-141660911 ACACTCCTGTACAAGGTGTCTGG - Intronic
940124667 2:150310231-150310253 ACACACCTGTAGGAGGTGGCTGG - Intergenic
941017192 2:160370606-160370628 CCACACATTTAGAAGGTGGCAGG + Intronic
942116678 2:172735624-172735646 GGACACCTGTCGCAGGTGGCCGG + Intronic
942197397 2:173535078-173535100 CCCCACCTGTTGAAGGAGGGAGG + Intergenic
943548785 2:189312657-189312679 ACACACCTGTGGGAGGTGGCTGG - Intergenic
943903770 2:193472945-193472967 CCACACTTGTAGCAATTGGCAGG - Intergenic
944501620 2:200366002-200366024 TCACACTAGTAGAAAGTGGCAGG - Intronic
944853291 2:203742399-203742421 CTAAAAATGTAGAAGGTGGCTGG - Intergenic
946363697 2:219235486-219235508 CCGCAACAGTATAAGGTGGCCGG - Exonic
946648784 2:221868838-221868860 ACACTCCTGTAGGAGGTGTCTGG - Intergenic
947463706 2:230323784-230323806 CCCCACCTTCAGAAGGTGGCCGG + Intergenic
947585476 2:231353709-231353731 CCACAGTCGTGGAAGGTGGCCGG - Intronic
948220938 2:236269342-236269364 CAACACCTTTAGAAAGTGCCTGG - Intergenic
1169907949 20:10622557-10622579 CTACACCTGAAAAAGGAGGCAGG - Intronic
1171282125 20:23909936-23909958 AGGCACCTGTAGAAAGTGGCTGG + Intergenic
1173001540 20:39109412-39109434 CCTCACCTGTACAAGATGTCAGG - Intergenic
1174056070 20:47799400-47799422 CCACACCTGTGGCAGGTGGGAGG - Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1176348963 21:5774683-5774705 ACACACCTGTAGGAGGTGACTGG - Intergenic
1176355777 21:5895267-5895289 ACACACCTGTAGGAGGTGACTGG - Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176543284 21:8172753-8172775 ACACACCTGTAGGAGGTGACTGG - Intergenic
1176562235 21:8355798-8355820 ACACACCTGTAGGAGGTGACTGG - Intergenic
1176819394 21:13642638-13642660 ACACACCTGTAGGATGTGACTGG - Intergenic
1176977123 21:15334876-15334898 ACACACCTGTAGGAGGGGGCTGG + Intergenic
1176987592 21:15455791-15455813 ACACTCCTGTATAAGGTGTCTGG + Intergenic
1179481586 21:41682001-41682023 CCCCAGCTGTGGGAGGTGGCGGG - Intergenic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1181417280 22:22769786-22769808 ACACACAAGTAGAAGGTGGTAGG + Intronic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181794823 22:25299233-25299255 CCCTTCCTGTAGAAGGTGGTTGG - Intergenic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1182708251 22:32303178-32303200 CGACACGTGTCCAAGGTGGCTGG + Intergenic
1183176106 22:36225846-36225868 CATCAGCTGTAGAAGGGGGCTGG - Intergenic
1203248153 22_KI270733v1_random:88972-88994 ACACACCTGTAGGAGGTGACTGG - Intergenic
951996522 3:28736191-28736213 GTATACCTGTAGGAGGTGGCTGG + Intergenic
952375878 3:32766851-32766873 CCATACCTGTAGTAGGGGACTGG + Intronic
953359054 3:42278983-42279005 CCCCACCTGTTGAAGGAGGGAGG + Intergenic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954445152 3:50542406-50542428 CCACCCCTGTAGAAGCTGCTGGG - Intergenic
954613739 3:51959201-51959223 CCACCCCTGCACAAGGAGGCAGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954736851 3:52714534-52714556 CCACAGCTGAAGCAGGTGTCCGG - Intronic
955435926 3:58899107-58899129 CTGCACCTGTAGGAGGAGGCTGG + Intronic
955750470 3:62181220-62181242 CCACATCGGAAGAAGGTGGCGGG + Intronic
956008822 3:64808600-64808622 CCACATCTGTAGGAGATGGAAGG + Intergenic
957199504 3:77113886-77113908 CTATACATGTAGAAGCTGGCAGG + Intronic
958650428 3:96930617-96930639 ACATGCCTGTAGGAGGTGGCCGG + Intronic
958702902 3:97616047-97616069 ACACACTTGTAGAAGGCGGCTGG - Intronic
959520449 3:107317787-107317809 AGGCACCTGTAGAAGGTGGCTGG + Intergenic
959950513 3:112175364-112175386 ACACACCTGTAGGAGGTAGCTGG + Intronic
959957273 3:112252870-112252892 ACACACCAGCAGGAGGTGGCTGG - Intronic
960608187 3:119529640-119529662 CCACACACGTAGGAGGTGTCCGG + Intronic
961418954 3:126784490-126784512 CCCCAACTGTGGAATGTGGCTGG + Intronic
962031613 3:131606782-131606804 CCAGACATTTAGAGGGTGGCTGG - Intronic
964255719 3:154772498-154772520 AAGCACCTGTAGGAGGTGGCTGG + Intergenic
965039000 3:163481985-163482007 TCACAGCTGTAGATGGTGGCAGG - Intergenic
966269817 3:178091076-178091098 ACACACCTGTAGGAGGTGGCTGG - Intergenic
966573745 3:181476809-181476831 ACACACCTGTAGGAGGTGGCTGG + Intergenic
966777464 3:183555563-183555585 GCTCATCTGTAGAAGGTGCCAGG + Exonic
967147517 3:186618538-186618560 CCACATAGGTAGAAGGTGGGAGG - Exonic
968390350 4:187658-187680 ACACAACTGTAGGAGGTGGCTGG + Intergenic
970124076 4:12789786-12789808 CCACACATCAAGAAGGTGGCTGG - Intergenic
975044361 4:69783501-69783523 ACACACCTGCCCAAGGTGGCAGG - Intronic
975106240 4:70571870-70571892 GCACACGTGTAGGAGGTGGGTGG + Intergenic
975297665 4:72752115-72752137 ACACACCTGTAGGAGTTGGCTGG - Intergenic
975489913 4:74976670-74976692 ACACTCCTGTATAAGGTGTCTGG - Intronic
975679998 4:76867091-76867113 ATACACCTGTAGGAGGTGGCTGG - Intergenic
975723481 4:77270263-77270285 CCACACCTGTGAAAGGAAGCAGG + Intronic
976030770 4:80751244-80751266 ACACACCTGTAGGAGGTGGCTGG + Intronic
976395511 4:84550747-84550769 ACGTACCTGTAGGAGGTGGCCGG - Intergenic
976527801 4:86114603-86114625 ACACTCCTGTAGGAGGTGTCTGG + Intronic
977006321 4:91572340-91572362 AGACACCTGTAGGAGGTGGCTGG + Intronic
977084376 4:92575703-92575725 ACCCTCCTGTAGGAGGTGGCTGG + Intronic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
979179567 4:117708098-117708120 ACACACCTGTAGGAGGTGGCTGG - Intergenic
980426927 4:132637359-132637381 GCACATCTTCAGAAGGTGGCAGG - Intergenic
980557772 4:134431263-134431285 CCATCCCTGTGGAGGGTGGCAGG - Intergenic
981790872 4:148535524-148535546 ACACACCTGTAGGAGGTGGTTGG + Intergenic
982646146 4:158027080-158027102 ATGCACCTGTAGGAGGTGGCTGG - Intergenic
983631304 4:169852362-169852384 CCACACCAGCAGAAGGGGCCAGG + Intergenic
983819025 4:172170359-172170381 CAACACCTTCACAAGGTGGCAGG - Intronic
983899022 4:173113348-173113370 ACACACCTGTAGGAGGTGACTGG - Intergenic
985667370 5:1188037-1188059 CCACAGCTGCTGAAGCTGGCGGG - Intergenic
986865074 5:11976679-11976701 CCAGACCTGCAGAAGGTGAGGGG + Intergenic
987674882 5:21062248-21062270 CCCCACCTGTAGGAGGTGGCTGG + Intergenic
988935955 5:36083160-36083182 ACACACCTATAGGAGGTGGCTGG - Intergenic
989818364 5:45764393-45764415 CCAGCCTTGAAGAAGGTGGCTGG + Intergenic
990230867 5:53712090-53712112 ACACTCCTGTAGAAGGTATCTGG + Intergenic
991038927 5:62156456-62156478 CCACACATCAAGTAGGTGGCAGG + Intergenic
993494052 5:88587247-88587269 ACACACCTATAGGAGGTGGCTGG - Intergenic
994277468 5:97855771-97855793 ATGCACCTGTAGAAGGTGGCTGG - Intergenic
994346729 5:98696499-98696521 ATATACCTGAAGAAGGTGGCTGG + Intergenic
994470074 5:100192490-100192512 ACACAACTGTAGGAGGTAGCTGG - Intergenic
995329650 5:110933191-110933213 ATGCACCTATAGAAGGTGGCTGG + Intergenic
995694891 5:114867479-114867501 ACATACCTGTACAAGGTGGCTGG - Intergenic
997204992 5:132043024-132043046 ATGCACCTGTAGGAGGTGGCTGG + Intergenic
997869130 5:137491446-137491468 CCACACCTGTGGCAAGTGGAGGG - Intronic
999028146 5:148259250-148259272 ACACACCTGCAGGATGTGGCTGG + Intergenic
1000508404 5:162150507-162150529 ACACACCTGAACAAAGTGGCTGG + Intronic
1000509729 5:162165747-162165769 ACACACCTATAGGAGGTGGCTGG - Intergenic
1000545658 5:162598120-162598142 CCACAGCTGTAGAAGACGGAAGG - Intergenic
1001950106 5:175810368-175810390 CAAAACCTGAAGAAGGTTGCTGG - Intronic
1002967307 6:1978822-1978844 ACGCACCTGGAGGAGGTGGCTGG - Intronic
1004025642 6:11815685-11815707 CTACATCTGTTGAAGGTGGGTGG - Intergenic
1006799581 6:36751385-36751407 CCACACGCCTAGATGGTGGCAGG - Intronic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007195432 6:40056104-40056126 ACACACCTGTAGGAGGTAGCTGG - Intergenic
1007215696 6:40235560-40235582 ACACACCTGTAGGAAGTGGCTGG - Intergenic
1007360297 6:41350737-41350759 CGTGACCTGTTGAAGGTGGCAGG - Exonic
1007829864 6:44629907-44629929 CAAGACCTGTAGAAGGAGGGAGG - Intergenic
1008270506 6:49483693-49483715 CCACACTTGGAGCAGCTGGCTGG - Intronic
1008973963 6:57402292-57402314 ACACACCTGTAGTTGGTGGCTGG + Intronic
1009060109 6:58388014-58388036 ATGCACCTGTAGAAGGTGTCTGG - Intergenic
1009162848 6:60303797-60303819 ACGCACCTGTAGTTGGTGGCTGG + Intergenic
1009230807 6:61059378-61059400 ATGCACCTGTAGAAGGTGTCTGG + Intergenic
1009289687 6:61867865-61867887 ACGTACCTGTAGGAGGTGGCTGG + Intronic
1009643900 6:66372782-66372804 ACACACCTGTAGGAGGTGGCTGG + Intergenic
1011137718 6:84117895-84117917 ATGCACCTGTAGGAGGTGGCTGG + Intergenic
1011370574 6:86633183-86633205 ACTCACCTGTAGGAGGTGGCTGG + Intergenic
1011635793 6:89372032-89372054 CCACACCTCTAGAAGGTCTTAGG - Intronic
1011921114 6:92577945-92577967 ACATGCCTGTAGGAGGTGGCTGG - Intergenic
1012869481 6:104656775-104656797 ACACACCTGTAGGAGGTATCTGG - Intergenic
1014532085 6:122570316-122570338 CCAGCCTTGTTGAAGGTGGCTGG - Intronic
1014943465 6:127470340-127470362 CCCCACATGTAGAGGGAGGCAGG - Intronic
1015494430 6:133865619-133865641 AGACACCTGTAGGAAGTGGCTGG + Intergenic
1015901988 6:138076705-138076727 ACATTCCTGTAGAAGGTTGCTGG - Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019204745 6:170350510-170350532 ACCCACCTGTAGGAGGTGGCTGG - Intronic
1020265415 7:6557063-6557085 CCACACCTGTGATGGGTGGCAGG + Intergenic
1021175893 7:17449487-17449509 AGGCACCTGTAGGAGGTGGCTGG + Intergenic
1021520955 7:21538547-21538569 ACACACCTGTAGGAGGTGGCTGG + Intergenic
1021841298 7:24723833-24723855 CCAGACCAGTAGATGGAGGCTGG + Intronic
1023753180 7:43391041-43391063 CCAAACCTTTAGAATTTGGCAGG + Intronic
1023838739 7:44083583-44083605 CCACACATGTTGAAGGTGCGAGG + Intergenic
1023886436 7:44360488-44360510 ACGCACCTGTAGGAGGTGGCTGG + Intergenic
1024866764 7:53912095-53912117 ACACACATGGAGAAGGTGGTGGG - Intergenic
1025236925 7:57240754-57240776 CCACACCTGCGGCAGGTGGGCGG + Intergenic
1026968545 7:74454592-74454614 CCAGACCGGGAGAAGGTGGAGGG - Intronic
1027576159 7:79933786-79933808 ACATGCCTGTAGGAGGTGGCTGG + Intergenic
1027627675 7:80564982-80565004 ACACACGTGTAGGAGGTAGCTGG + Intronic
1028633481 7:92961661-92961683 CCATACCTGTAAAAGAAGGCTGG - Intergenic
1029052120 7:97700307-97700329 ACACACTTGTAGGAAGTGGCTGG - Intergenic
1029349182 7:100000876-100000898 TCACACCTGTAGGAGGTGGGAGG + Intergenic
1029505462 7:100961108-100961130 CCTCACCCTTAGGAGGTGGCTGG + Intronic
1030809456 7:113956560-113956582 ACAGACCTGTAGGAGGTGGCTGG + Intronic
1030830159 7:114210566-114210588 ATACAACTGTAGGAGGTGGCTGG + Intronic
1032255992 7:130297522-130297544 CCACTCCTGCTGCAGGTGGCTGG - Intronic
1033565112 7:142570528-142570550 ACACACCTGTAGGAGGTGGCTGG - Intergenic
1034364414 7:150534048-150534070 ACACACCTGTAGGAGGTGGCTGG + Intergenic
1034896348 7:154878704-154878726 CCACCCCTGTGGAAGGCAGCGGG + Intronic
1037198481 8:16221244-16221266 ACATACCTGTAGGAGGTGGCTGG - Intronic
1037198677 8:16223503-16223525 ACACACCTGTAGGAGGTGGCTGG + Intronic
1038021535 8:23555368-23555390 TCCAACCTGGAGAAGGTGGCTGG - Intronic
1040087787 8:43364252-43364274 ACACACCTGTAGGAGGTGGCTGG - Intergenic
1040404614 8:47087549-47087571 ACACACCTATAGGAGGTGGCTGG + Intergenic
1040965589 8:53077904-53077926 CCACACTTGGAGCAGCTGGCTGG - Intergenic
1041566110 8:59280731-59280753 CCACACCTGGAGAGGGTGGTTGG - Intergenic
1041623729 8:60001252-60001274 ACATACCTGCAGATGGTGGCTGG - Intergenic
1043102237 8:76060683-76060705 CCACACTTGGAGAAGCCGGCCGG - Intergenic
1043301823 8:78744001-78744023 ACGCACCTGCAGGAGGTGGCTGG + Intronic
1043363126 8:79499254-79499276 ACATACCTGTAGGAGGTGGCTGG + Intergenic
1043396560 8:79843050-79843072 ACACACCTGCAGGAGGTGGCTGG - Intergenic
1048267683 8:133001845-133001867 CCACACCTGCACAGGCTGGCTGG - Intronic
1048354582 8:133642788-133642810 CCCCACCTGTGGAAGGCGGAAGG + Intergenic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049526697 8:143130447-143130469 CCACACGGGTAGTAGGAGGCAGG + Intergenic
1049598062 8:143493474-143493496 CCACACCTGGAGAAGGTGGAAGG + Intronic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1050986591 9:12091131-12091153 CCAACCCTGATGAAGGTGGCTGG + Intergenic
1051913984 9:22185725-22185747 ACACACCTGTAGGAGGTGTCTGG - Intergenic
1052358677 9:27530217-27530239 CCACACAAGTAGAGAGTGGCGGG - Intergenic
1052515255 9:29472182-29472204 ACACACCTGTAGGAGGTGGCTGG + Intergenic
1052766934 9:32650871-32650893 AGACACCTGTAGGAGGTTGCTGG - Intergenic
1052852778 9:33387880-33387902 CCACAGCTGGAGAAGGACGCTGG - Intronic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053678780 9:40465192-40465214 ACACTCCTGTATAAGGTGCCTGG - Intergenic
1053928765 9:43093545-43093567 ACACTCCTGTATAAGGTGCCTGG - Intergenic
1054160706 9:61670557-61670579 CCACATCTGGAGAGGCTGGCAGG + Intergenic
1054284943 9:63159750-63159772 ACACTCCTGTATAAGGTGCCTGG + Intergenic
1054291858 9:63300730-63300752 ACACTCCTGTATAAGGTGCCTGG - Intergenic
1054389876 9:64605273-64605295 ACACTCCTGTATAAGGTGCCTGG - Intergenic
1054505838 9:65911103-65911125 ACACTCCTGTATAAGGTGCCTGG + Intergenic
1055132650 9:72793582-72793604 ACGCACCTGTAGGAGGTGGTTGG - Intronic
1055842232 9:80519214-80519236 ACACACCTGTAGAAGCTGGTTGG + Intergenic
1056095728 9:83251084-83251106 ATGCACCTGTAGGAGGTGGCTGG - Intronic
1056924957 9:90826602-90826624 CCAGAGCTGTAGAAGCTGGAAGG - Intronic
1056929641 9:90863288-90863310 CCACACATGTTCAAGGTAGCTGG - Intronic
1057291115 9:93808047-93808069 CCACAGCCACAGAAGGTGGCTGG + Intergenic
1058461724 9:105189777-105189799 ACATACCTGTAGGAGGTGGCTGG + Intergenic
1059076376 9:111197623-111197645 ACTGACCTGTAGGAGGTGGCTGG - Intergenic
1060732793 9:126048793-126048815 CCACATCTGTAAAATGCGGCTGG + Intergenic
1061016702 9:127985198-127985220 TCACACCTGGAGAAAGTGGGAGG + Intergenic
1061315785 9:129795032-129795054 GGACACCTGGGGAAGGTGGCAGG + Intergenic
1061723360 9:132567483-132567505 CCATACCCCAAGAAGGTGGCTGG - Intronic
1062052734 9:134455930-134455952 CCACACCTGTCCTAGGTGCCTGG + Intergenic
1062239119 9:135526429-135526451 CCACCCCTGCAGAACGCGGCTGG + Exonic
1062426828 9:136510005-136510027 CCACACCTGCGGGAGGGGGCCGG + Intronic
1062569768 9:137179695-137179717 ACAGACCTGGAGAAGGGGGCAGG + Intronic
1203527964 Un_GL000213v1:106932-106954 ACACACCTGTAGGATGTGACTGG + Intergenic
1203464555 Un_GL000220v1:72223-72245 ACACACCTGTAGGAGGTGACTGG - Intergenic
1185637098 X:1560734-1560756 GCACACCTTCACAAGGTGGCAGG - Intergenic
1186964365 X:14772023-14772045 ACATACCTGTAGGAGGTGGCTGG + Intergenic
1187000005 X:15166904-15166926 CAACACCTATAGAAGGAAGCAGG - Intergenic
1188237508 X:27747948-27747970 CCACAACTTTTGAAGCTGGCCGG - Exonic
1188257447 X:27980356-27980378 CCACAACTTTTGAAGCTGGCCGG + Exonic
1188869754 X:35359391-35359413 ACACACCTATAGGAGGTGGCTGG + Intergenic
1189436987 X:41001712-41001734 CAACACCTGTGGAAGGTAGGAGG - Intergenic
1189652251 X:43203232-43203254 ACGCACCTGTAGGAGGTGGCTGG + Intergenic
1189855039 X:45215169-45215191 ATGCACCTGTAGGAGGTGGCTGG - Intergenic
1190133126 X:47769046-47769068 ATGCACCTGTAGGAGGTGGCTGG - Intergenic
1190304734 X:49075539-49075561 GCTCACCAGTAGAGGGTGGCAGG + Exonic
1190410851 X:50135861-50135883 CCACCCCTGTGGCTGGTGGCTGG + Intergenic
1190600563 X:52088572-52088594 ACACACCTGTAGGAGGTGGCTGG + Intergenic
1190803291 X:53812849-53812871 ACACACCTGTAGGAGATGGCAGG + Intergenic
1191094662 X:56661614-56661636 ACACACTTGTAGGAGGTGGATGG + Intergenic
1191703154 X:64064547-64064569 ATACACCTGTAGGAGGTGACTGG - Intergenic
1191738962 X:64417170-64417192 ACACACTTCTAGGAGGTGGCTGG + Intergenic
1191877033 X:65807613-65807635 ACACACCTGTAGGAGGTGGATGG - Intergenic
1191930237 X:66364646-66364668 AAGCACCTGTAGGAGGTGGCTGG + Intergenic
1191988812 X:67010177-67010199 ACACACCTGTAGGAGGTGCCTGG - Intergenic
1191993861 X:67068753-67068775 ACACACCTGTAGGAGGTGGCTGG - Intergenic
1192723337 X:73723535-73723557 ACACACCTGTAGAATGTGGCTGG + Intergenic
1193061757 X:77214707-77214729 ACACATCTGTAGGAGGTGGCTGG + Intergenic
1193714966 X:84927155-84927177 AGTCACCTGTAGAAGGTGTCTGG + Intergenic
1193933108 X:87581440-87581462 ACGCACCTGTAGGAGGTGGGTGG - Intronic
1194594017 X:95836055-95836077 ACACACCTGTAGGAGGTGGCTGG + Intergenic
1194867519 X:99086628-99086650 ACGCACCTGTAGGAGGTGGCTGG - Intergenic
1195104732 X:101593272-101593294 ATGCACCTGTAGGAGGTGGCTGG + Intergenic
1195148643 X:102043595-102043617 ACGCACCTGTAGGAGGTGGTTGG - Intergenic
1195928310 X:110048514-110048536 CCACATCTGTAAAAGAGGGCGGG - Intronic
1196152716 X:112392496-112392518 ACACACTTGTAGGAGGTGGCTGG + Intergenic
1196381860 X:115099166-115099188 ACACTCCTGTATAAGGTGTCTGG - Intergenic
1196582270 X:117392260-117392282 ACACACCTATAGGTGGTGGCTGG - Intergenic
1197428149 X:126323654-126323676 ATGCACCTGTAGGAGGTGGCTGG - Intergenic
1197434841 X:126414086-126414108 TCACACCTGTAGGGGGTGGGGGG + Intergenic
1197489610 X:127101087-127101109 ACACTCCTGTAGGAGGTGTCTGG - Intergenic
1197680432 X:129377128-129377150 CCACAGCTGGAGAAGGTGGGAGG - Intergenic
1198705491 X:139443821-139443843 ACGCACCTGTAGGAGGTGGCTGG - Intergenic
1198989141 X:142490812-142490834 CCACACTTGTAAAAGCTGGACGG + Intergenic
1199160740 X:144608003-144608025 CGACACGTGTACAAGGTGGTCGG + Intergenic
1199476867 X:148255369-148255391 CCCCACATGTAGAACCTGGCAGG + Intergenic
1199596033 X:149506491-149506513 CAACACCTGTAGAAGGGGAGGGG - Intronic
1200039692 X:153356060-153356082 CCCCACCTGAGGAAGGTGGAGGG + Intronic
1200149079 X:153942726-153942748 CCCCACCTGGGGAAGGTGGAGGG - Intronic
1200161705 X:154013035-154013057 CCACAGCCGTGGAAGGTAGCTGG - Exonic
1200953980 Y:8927295-8927317 CCACAGCTGGGTAAGGTGGCAGG + Intergenic
1201936027 Y:19411759-19411781 ATACACCTGTAGGAGGAGGCTGG - Intergenic