ID: 1115389729

View in Genome Browser
Species Human (GRCh38)
Location 14:32841407-32841429
Sequence CACACCTAACACTAAAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115389729_1115389731 -7 Left 1115389729 14:32841407-32841429 CCAAGATTTTAGTGTTAGGTGTG No data
Right 1115389731 14:32841423-32841445 AGGTGTGTTTATTGCTACTAGGG No data
1115389729_1115389732 27 Left 1115389729 14:32841407-32841429 CCAAGATTTTAGTGTTAGGTGTG No data
Right 1115389732 14:32841457-32841479 CTTGATGCTTTCAGCCAACAAGG No data
1115389729_1115389730 -8 Left 1115389729 14:32841407-32841429 CCAAGATTTTAGTGTTAGGTGTG No data
Right 1115389730 14:32841422-32841444 TAGGTGTGTTTATTGCTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115389729 Original CRISPR CACACCTAACACTAAAATCT TGG (reversed) Intergenic
No off target data available for this crispr