ID: 1115391562

View in Genome Browser
Species Human (GRCh38)
Location 14:32860479-32860501
Sequence ACAGAGCCACAGAGGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115391562_1115391570 17 Left 1115391562 14:32860479-32860501 CCTGGCTCCCTCTGTGGCTCTGT No data
Right 1115391570 14:32860519-32860541 AGGCCCCCTCTACAGGGTCCTGG No data
1115391562_1115391567 10 Left 1115391562 14:32860479-32860501 CCTGGCTCCCTCTGTGGCTCTGT No data
Right 1115391567 14:32860512-32860534 GAAGACCAGGCCCCCTCTACAGG No data
1115391562_1115391568 11 Left 1115391562 14:32860479-32860501 CCTGGCTCCCTCTGTGGCTCTGT No data
Right 1115391568 14:32860513-32860535 AAGACCAGGCCCCCTCTACAGGG No data
1115391562_1115391565 -3 Left 1115391562 14:32860479-32860501 CCTGGCTCCCTCTGTGGCTCTGT No data
Right 1115391565 14:32860499-32860521 TGTCATCCTGCTTGAAGACCAGG No data
1115391562_1115391571 18 Left 1115391562 14:32860479-32860501 CCTGGCTCCCTCTGTGGCTCTGT No data
Right 1115391571 14:32860520-32860542 GGCCCCCTCTACAGGGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115391562 Original CRISPR ACAGAGCCACAGAGGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr