ID: 1115395842

View in Genome Browser
Species Human (GRCh38)
Location 14:32907375-32907397
Sequence CAGAACAAGGAGAAGAGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115395842_1115395844 -10 Left 1115395842 14:32907375-32907397 CCTCTACTCTTCTCCTTGTTCTG No data
Right 1115395844 14:32907388-32907410 CCTTGTTCTGTTGTGCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115395842 Original CRISPR CAGAACAAGGAGAAGAGTAG AGG (reversed) Intergenic
No off target data available for this crispr