ID: 1115396843

View in Genome Browser
Species Human (GRCh38)
Location 14:32918423-32918445
Sequence TCTCATCATCTCTGAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115396843_1115396847 18 Left 1115396843 14:32918423-32918445 CCTGAGCTTCAGAGATGATGAGA No data
Right 1115396847 14:32918464-32918486 CTAATAATCGAGCACCAGTTGGG No data
1115396843_1115396846 17 Left 1115396843 14:32918423-32918445 CCTGAGCTTCAGAGATGATGAGA No data
Right 1115396846 14:32918463-32918485 ACTAATAATCGAGCACCAGTTGG No data
1115396843_1115396844 -10 Left 1115396843 14:32918423-32918445 CCTGAGCTTCAGAGATGATGAGA No data
Right 1115396844 14:32918436-32918458 GATGATGAGATGCTTAGTAGAGG No data
1115396843_1115396845 -6 Left 1115396843 14:32918423-32918445 CCTGAGCTTCAGAGATGATGAGA No data
Right 1115396845 14:32918440-32918462 ATGAGATGCTTAGTAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115396843 Original CRISPR TCTCATCATCTCTGAAGCTC AGG (reversed) Intergenic
No off target data available for this crispr