ID: 1115401747

View in Genome Browser
Species Human (GRCh38)
Location 14:32969315-32969337
Sequence CACCCACACCGCACCAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 181}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115401747_1115401758 13 Left 1115401747 14:32969315-32969337 CCAACCCTGGTGCGGTGTGGGTG 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1115401758 14:32969351-32969373 ACATGAGGGTGCCAAGTACTAGG 0: 1
1: 0
2: 1
3: 10
4: 122
1115401747_1115401756 -2 Left 1115401747 14:32969315-32969337 CCAACCCTGGTGCGGTGTGGGTG 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1115401756 14:32969336-32969358 TGGGGAGTGGGGAGTACATGAGG 0: 1
1: 0
2: 2
3: 57
4: 505
1115401747_1115401759 16 Left 1115401747 14:32969315-32969337 CCAACCCTGGTGCGGTGTGGGTG 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1115401759 14:32969354-32969376 TGAGGGTGCCAAGTACTAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 124
1115401747_1115401757 -1 Left 1115401747 14:32969315-32969337 CCAACCCTGGTGCGGTGTGGGTG 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1115401757 14:32969337-32969359 GGGGAGTGGGGAGTACATGAGGG 0: 1
1: 0
2: 4
3: 51
4: 417
1115401747_1115401760 21 Left 1115401747 14:32969315-32969337 CCAACCCTGGTGCGGTGTGGGTG 0: 1
1: 0
2: 2
3: 17
4: 181
Right 1115401760 14:32969359-32969381 GTGCCAAGTACTAGGAGGTGTGG 0: 1
1: 0
2: 3
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115401747 Original CRISPR CACCCACACCGCACCAGGGT TGG (reversed) Intronic
900163609 1:1236077-1236099 CACCCCCACCCCACCAGGCAAGG + Intergenic
900418175 1:2544499-2544521 CACCCACACCGAGCAGGGGTGGG - Intergenic
901532708 1:9863598-9863620 CACCTACACTGCACCAGAGGCGG + Intronic
903015576 1:20359414-20359436 CACACACACAGCCCCATGGTAGG - Intergenic
905967869 1:42114429-42114451 CACCCACCCTGCTCCAGGGTGGG - Intergenic
906696299 1:47825621-47825643 CACCTACTCCGCACCAGGCTGGG - Intronic
907308211 1:53525308-53525330 CACCCACACAGGGCCAGGCTAGG + Intronic
908353328 1:63307829-63307851 CTCCCACATTGCATCAGGGTTGG + Intergenic
908650276 1:66325426-66325448 CACCCACCCAGCAGCAGGCTTGG + Intronic
908829265 1:68163395-68163417 CACCGCCACCGCCGCAGGGTGGG - Intronic
911925593 1:103827175-103827197 CACCCACACTGTACCAAGGCTGG + Intergenic
912813015 1:112808077-112808099 CTCTCACATCGTACCAGGGTTGG + Intergenic
915273942 1:154775248-154775270 CGCCCACACCACACCAGGCCTGG - Intronic
916689786 1:167179304-167179326 CTCCCACACGGTATCAGGGTTGG + Intergenic
916720865 1:167484008-167484030 CTCCCACACGGCACCAGCGGTGG - Intronic
917123377 1:171664242-171664264 TTCCCACATCACACCAGGGTTGG + Intergenic
917322007 1:173792412-173792434 CTCCCAAAATGCACCAGGGTTGG + Intergenic
918049551 1:180962393-180962415 CGCCCACACAGCCCCAGGGAAGG + Intergenic
918103414 1:181396294-181396316 CTCCCACACTGTACCAGGGTTGG - Intergenic
920250161 1:204618012-204618034 CACCCACACCCTTCCTGGGTTGG + Exonic
922603973 1:226877540-226877562 CACCCCCACCCCACCAGGCTAGG + Intronic
924125533 1:240846674-240846696 CTCCCACACTGCACCAGGGTTGG + Intronic
924233613 1:241982396-241982418 CACCCACACCCCTCCAGTCTCGG + Intergenic
1069840800 10:71338123-71338145 CACCCAGACTGGCCCAGGGTGGG - Intronic
1070717771 10:78734939-78734961 CACCTCCACGGCAGCAGGGTGGG + Intergenic
1070768716 10:79070333-79070355 CGCCCCCACCGCTCCAGGGCGGG - Intronic
1072129850 10:92483755-92483777 CTCCCACACTACACCAGGGTTGG + Intronic
1073495904 10:103890657-103890679 CTCCCACACCGTCCCAGGATGGG - Intronic
1074037825 10:109758399-109758421 CACTCACACAGCAGCTGGGTAGG + Intergenic
1077059221 11:610403-610425 CACACACACCACACTAGGCTGGG + Intronic
1077917892 11:6622888-6622910 CACCCACACCGCACTGGGCCTGG - Exonic
1080388641 11:31825117-31825139 CCCCCACCCCGCCCCAGGCTGGG + Intronic
1080793259 11:35539854-35539876 CTCCCACAGTGTACCAGGGTTGG + Intergenic
1081699088 11:45141315-45141337 CTCCCACACTGTACCAGGGTTGG + Intronic
1083772727 11:64877597-64877619 GACCCACACCGCACCAGAGAAGG + Intronic
1087605019 11:100366687-100366709 CACCCACTCTGGAGCAGGGTAGG - Intergenic
1088739780 11:112757731-112757753 CACACACACCACAGCTGGGTGGG + Intergenic
1088971598 11:114779341-114779363 CCCCCACACCGCCCCAGGCCAGG - Intergenic
1089200862 11:116724039-116724061 CACCCGCACCACCCCAGGGATGG - Intergenic
1089355692 11:117851175-117851197 CTCCCACACTGCACCAGGGTTGG + Intronic
1096789559 12:54036310-54036332 GACCCTCACCCCACCAGTGTGGG - Intronic
1097883850 12:64709613-64709635 CTCCCACAATGCATCAGGGTTGG - Intergenic
1098167067 12:67709753-67709775 CTCCCACACTGTATCAGGGTTGG - Intergenic
1103536833 12:121639049-121639071 CACCCAGCCTGCACCAGGGCTGG + Intronic
1104679506 12:130739727-130739749 CACTCACACCCTTCCAGGGTGGG - Intergenic
1113607756 13:111622428-111622450 CATCCACCCCTCACCAGTGTGGG + Intronic
1113757727 13:112825285-112825307 CGCCCTCAACGCACCACGGTGGG - Intronic
1113807350 13:113117618-113117640 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807360 13:113117655-113117677 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807371 13:113117692-113117714 CACCCACCCAGCACCGCGGTCGG - Intronic
1113807382 13:113117729-113117751 CACCCACCCAGCACCGCGGTCGG - Intronic
1115401747 14:32969315-32969337 CACCCACACCGCACCAGGGTTGG - Intronic
1115502553 14:34062498-34062520 CACCCAGCCCGCCCCAGGGTGGG - Intronic
1119873947 14:78040805-78040827 CCCCCACATGGTACCAGGGTTGG + Intergenic
1121436758 14:93925733-93925755 CCCCGACCCCGCAGCAGGGTAGG + Intronic
1122343896 14:101046167-101046189 CGCCCACACTGCACCAGGAGAGG - Intergenic
1122608401 14:102963723-102963745 CTCCCACAGCCCAACAGGGTAGG - Intronic
1123932250 15:25177542-25177564 CACCCACCCTTCTCCAGGGTTGG - Intergenic
1124158018 15:27245142-27245164 CTCCCACACCGCAGCAGAGGAGG - Intronic
1124371602 15:29107470-29107492 CACCAAGACCACAGCAGGGTGGG - Intronic
1125337003 15:38636591-38636613 CTCCCACAGTGGACCAGGGTTGG + Intergenic
1127389540 15:58494278-58494300 CTCCCACATTGCACCAGGGTTGG - Intronic
1127879690 15:63145798-63145820 CTCCCACACCAAATCAGGGTTGG - Intronic
1128561538 15:68671845-68671867 CTCCCATATTGCACCAGGGTTGG - Intronic
1129606029 15:77025421-77025443 CACCCACAACTCACCCGTGTGGG - Intronic
1131194652 15:90345894-90345916 CTCCCACACTGTACCAGGGTTGG + Intergenic
1132573983 16:656426-656448 CTCCCACACCGCCCCGGTGTTGG + Exonic
1132798806 16:1741411-1741433 CACCCACACAGCTCCATGCTGGG - Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1134879112 16:17728770-17728792 CATCCACAAGGCACCAGGCTAGG - Intergenic
1136481044 16:30542025-30542047 CATCCACACCGCACAGGGGGAGG - Intronic
1136482120 16:30548582-30548604 CACCCACACTGCACAGGGGGAGG - Intronic
1136623318 16:31444355-31444377 TTCCCACAATGCACCAGGGTTGG + Intergenic
1138448433 16:57078912-57078934 CATCCACACAGGACCTGGGTAGG - Intronic
1139364784 16:66426909-66426931 CACCCACACAGCAGCAGGCGGGG - Intergenic
1141746309 16:85928826-85928848 AACCCACACTGGACCTGGGTAGG - Intergenic
1143033515 17:3981532-3981554 AAGCCACACAGCACCAGGGGAGG - Intergenic
1143203315 17:5127007-5127029 GACTGACCCCGCACCAGGGTGGG + Intronic
1143691051 17:8566317-8566339 CTCCCACACAGTATCAGGGTTGG + Intronic
1144065285 17:11619102-11619124 CACCTTCACCACAACAGGGTGGG - Intronic
1144202080 17:12950646-12950668 CCCCCACACAACAGCAGGGTGGG + Intronic
1144874481 17:18390332-18390354 AACCGACCCCGCACCAGGGTGGG + Intergenic
1146519851 17:33517902-33517924 CACCCACATTGCAACAGGCTTGG - Intronic
1146526593 17:33572301-33572323 CACCCCCCCCACCCCAGGGTAGG + Intronic
1147184901 17:38707746-38707768 CCCCCACACTGCCCCAGGCTGGG + Exonic
1147996577 17:44363187-44363209 CGCCCCCACCCCGCCAGGGTCGG + Intronic
1148497302 17:48060511-48060533 CACAAACACCGGACCAGGGGAGG - Exonic
1149848677 17:60022143-60022165 GACCGACCCTGCACCAGGGTAGG - Intergenic
1149861492 17:60124381-60124403 GACCGACCCTGCACCAGGGTAGG + Intergenic
1150063399 17:62088321-62088343 CACCGTCACCCCACCAGGATGGG + Intergenic
1151329910 17:73400583-73400605 GACCCACACAGCACAAGGGAAGG + Intronic
1151439927 17:74121817-74121839 CTCCCACACTGTACCAGAGTTGG - Intergenic
1151530089 17:74698544-74698566 CACCCACCCAGCAGCAGGGGAGG + Intronic
1152926510 17:83090139-83090161 CCCCCGCCCCGCCCCAGGGTGGG + Intronic
1152926539 17:83090203-83090225 CCCCCGCCCCGCCCCAGGGTGGG + Intronic
1156244513 18:35284663-35284685 CACCCCCACCTCAGCAGGCTTGG - Intronic
1158506036 18:58045980-58046002 CACACACACCATGCCAGGGTAGG - Intronic
1162316238 19:9939828-9939850 CCCCCACCCCCCACCATGGTGGG - Intergenic
1162775487 19:12976345-12976367 CACACACACCCCATCAGGTTGGG - Intergenic
1163630324 19:18415113-18415135 AACCCAAACAACACCAGGGTGGG - Intergenic
1165246290 19:34500282-34500304 CACCCACCCCGGCCCAGGGACGG - Exonic
1165427830 19:35755554-35755576 CATCCAGGCCGCACCAGCGTCGG - Exonic
1165652736 19:37505662-37505684 CTCCCACATTGTACCAGGGTTGG - Intergenic
1166569100 19:43782466-43782488 CACCCACACAACACCAGCATCGG + Intergenic
1166878191 19:45911032-45911054 CACCCACAAAGAACCAGGGCAGG - Intergenic
1168007771 19:53505191-53505213 CACCCACACCGCACTACAGCAGG + Intergenic
925833367 2:7918188-7918210 TTCCCACACTGTACCAGGGTTGG - Intergenic
929536408 2:42787034-42787056 CACCAAAACCTCAGCAGGGTGGG + Intronic
935949351 2:108314701-108314723 CATACACACAGCACAAGGGTGGG + Intergenic
938201634 2:129377231-129377253 CAGCCCCACAGCCCCAGGGTTGG - Intergenic
947577128 2:231284709-231284731 CCTCCACACTGTACCAGGGTGGG - Intronic
949048262 2:241882151-241882173 CACCCACGCTGCACCCGGGGAGG - Intergenic
1168932903 20:1638273-1638295 CTCCCTCACCTTACCAGGGTGGG - Intronic
1169353130 20:4886121-4886143 CACCCAGGCAGCTCCAGGGTGGG + Intronic
1170567025 20:17613263-17613285 CACCCACACCCCAGGAGGGTGGG - Intergenic
1172660316 20:36563639-36563661 CAACTACACAGCACCAGGGTAGG + Intergenic
1173944354 20:46938770-46938792 CTCCCACACAGTACCTGGGTTGG - Intronic
1174553910 20:51380643-51380665 CCCCCACCCCCCACCAGGGAGGG + Intergenic
1175806673 20:61833151-61833173 AACCCACACCACTCCAGGATAGG + Intronic
1175965245 20:62657083-62657105 CGCACACACCGCGCCGGGGTTGG - Exonic
1176155587 20:63618502-63618524 GACCTACACCGCACAGGGGTTGG + Intronic
1179899030 21:44379419-44379441 CACCCGCAGCACACCAGGGCGGG + Intronic
1179902743 21:44402400-44402422 CACCCACACCTCCACAGGGAGGG - Intronic
1181522888 22:23459637-23459659 CACCCACACAGCCCCAGGTCAGG - Intergenic
1183475959 22:38035870-38035892 AACCCACAAAGCTCCAGGGTGGG + Intronic
1184279003 22:43426597-43426619 CACACACACCCCACCAGGCCAGG - Intronic
950444023 3:13025823-13025845 CACCCACAGGAGACCAGGGTGGG + Intronic
953584465 3:44187137-44187159 CTCCCACACTGTACCAGGATTGG + Intergenic
954883799 3:53854615-53854637 CACCCACATGACACCAGGCTGGG + Intronic
956389420 3:68755573-68755595 TTCCCACATGGCACCAGGGTTGG + Intronic
963107694 3:141660525-141660547 CACCCGCACAGCCCCAGGGCGGG + Intergenic
963864239 3:150343062-150343084 CTCCCACACTGCATCAGGATTGG - Intergenic
966692060 3:182752033-182752055 CTCCCACACTGTATCAGGGTTGG + Intergenic
968090677 3:195896430-195896452 CACCCCAAGCACACCAGGGTAGG + Intronic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
972730262 4:41788039-41788061 CACCCCCACCTCACCCGGGATGG + Intergenic
972908241 4:43778386-43778408 CTCCCACACTGTACCAGGGTTGG + Intergenic
985966279 5:3340848-3340870 GACAGACACTGCACCAGGGTGGG + Intergenic
989173837 5:38500801-38500823 CTCCCACATTGCATCAGGGTTGG + Intronic
990696156 5:58419771-58419793 CTCCCACATTGTACCAGGGTTGG + Intergenic
990812810 5:59748132-59748154 CTCTCACACTGTACCAGGGTTGG + Intronic
996744005 5:126829707-126829729 CACTCACACTGGACTAGGGTGGG + Intronic
997391981 5:133524673-133524695 CCCCCACCCCGCCCCTGGGTGGG + Intronic
999131436 5:149286372-149286394 CAAACAAACAGCACCAGGGTAGG + Intronic
999429108 5:151510877-151510899 AACTCAAACCACACCAGGGTGGG + Intronic
1000647301 5:163774106-163774128 CACCCTCAAAGCACCAGGGAGGG + Intergenic
1001565073 5:172694771-172694793 AACCCCCACCGCACCAGGCTAGG - Intergenic
1002311526 5:178318051-178318073 CAGCCACACCGTATCAGGGAGGG + Intronic
1002709181 5:181184042-181184064 CAACCAGACCGCAGCAGGATTGG - Intergenic
1003942929 6:11045539-11045561 CTCCCACACCGCCCCAGGTGTGG - Intergenic
1004064844 6:12233893-12233915 CAACCACACAGCACAAGTGTAGG + Intergenic
1006203684 6:32320311-32320333 CACCCACACAGGTCCAGAGTTGG - Intronic
1014013159 6:116500027-116500049 CTCCTACATGGCACCAGGGTTGG + Intronic
1014377925 6:120700153-120700175 GTCCCACACCGCAGCAGGATGGG + Intergenic
1015785529 6:136919071-136919093 CTCCCACGCTGTACCAGGGTTGG - Intergenic
1017972484 6:159325394-159325416 GACCTCCACCGCACCAGGGCTGG + Intergenic
1018182349 6:161235082-161235104 CAACCACCCCACACCAGGCTAGG - Intronic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019588437 7:1816900-1816922 CACCCACACAGCCCCAGGTCAGG + Intronic
1019736772 7:2653964-2653986 CACACACACCGCCCCAGGACTGG + Intronic
1029368897 7:100134973-100134995 CACCCCCACTGCACCAGCCTGGG - Intergenic
1030470743 7:109959645-109959667 CACCAACACCTCTCCAGGCTTGG + Intergenic
1031081004 7:117256929-117256951 CCCCCACACCAACCCAGGGTGGG + Intergenic
1033477038 7:141701760-141701782 CCCGCACCCCGCACCAGGGCCGG - Intronic
1034285014 7:149878782-149878804 CGCCCACACAGTACCTGGGTCGG - Intronic
1035649609 8:1254909-1254931 CACACACACAGCACCTGGGCAGG - Intergenic
1035649616 8:1254938-1254960 CACACACACAGCACCCGGGCAGG - Intergenic
1035649652 8:1255153-1255175 CACACACACAGCACCCGGGCAGG - Intergenic
1035649671 8:1255249-1255271 CACACACACAGCACCCGGGCAGG - Intergenic
1035649683 8:1255310-1255332 CACACACACAGCACCCGGGCAGG - Intergenic
1035649696 8:1255374-1255396 CACACACACAGCACCCGGGCAGG - Intergenic
1035649762 8:1255819-1255841 CACACACACAGCACCTGGGCAGG - Intergenic
1035649777 8:1255909-1255931 CACACACACAGCACCTGGGCAGG - Intergenic
1035649798 8:1256026-1256048 CACACACACAGCACCCGGGCAGG - Intergenic
1035649834 8:1256231-1256253 CACACACACAGCACCCGGGCAGG - Intergenic
1035649856 8:1256350-1256372 CACACACACAGCACCCGGGCAGG - Intergenic
1037529337 8:19757874-19757896 CTCTCACACCGCACCACTGTGGG + Intronic
1039990194 8:42481342-42481364 ACACCACACCACACCAGGGTAGG + Intronic
1040944972 8:52874470-52874492 CACCCACACCCCACCAGCAAAGG - Intergenic
1041014526 8:53579103-53579125 CACCGGCAGTGCACCAGGGTTGG + Intergenic
1045372087 8:101534534-101534556 CTCCCACACTGGACCAGGGTTGG - Intronic
1045506058 8:102779576-102779598 AACCCACACAGCACCTGGCTCGG + Intergenic
1046599622 8:116300900-116300922 CACACGCGCCACACCAGGGTTGG - Intergenic
1047724846 8:127675080-127675102 CTCCCACATTGTACCAGGGTGGG - Intergenic
1049678318 8:143903321-143903343 CACGCACAGGGCTCCAGGGTGGG + Intergenic
1051083816 9:13323580-13323602 CACGCTCACCGCCCCAGGCTTGG - Intergenic
1052337895 9:27338287-27338309 CACCCACACCCAAGCAGGGCTGG - Intronic
1054763621 9:69024887-69024909 CTCCCACAGTGTACCAGGGTTGG - Intergenic
1057453944 9:95190664-95190686 CACCCACACAGTGCCAGGGCGGG - Intronic
1058849259 9:108994727-108994749 CTCCCACATCATACCAGGGTTGG + Intronic
1059470387 9:114500785-114500807 CTCCGAAACAGCACCAGGGTTGG + Intronic
1061754313 9:132802252-132802274 CTCCCACACCACACCGGGGAAGG - Intronic
1061764565 9:132873713-132873735 CACCCACTCGGCCTCAGGGTGGG + Intronic
1062277046 9:135736175-135736197 CACCCACCCCACACCAGGGCTGG + Intronic
1062427589 9:136513007-136513029 CACCCACCCCTCACCTGTGTAGG + Exonic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1189295910 X:39917516-39917538 CTCCCACATTGTACCAGGGTTGG - Intergenic
1195251374 X:103051482-103051504 CATCCGGACCGCACCAGGGGAGG - Intergenic
1195856576 X:109338612-109338634 CCCCCACTCCTCACCAGGCTGGG - Intergenic
1198502131 X:137260727-137260749 CTCCTACACTGTACCAGGGTTGG - Intergenic
1201431364 Y:13906147-13906169 AACCCACACAGCAAAAGGGTGGG - Intergenic