ID: 1115401960

View in Genome Browser
Species Human (GRCh38)
Location 14:32971768-32971790
Sequence CCGTTTGGAGACCATGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115401960 Original CRISPR CCGTTTGGAGACCATGATTA TGG (reversed) Intronic
913287798 1:117242805-117242827 CTGTTTTGTGACCATGATTGGGG - Intergenic
914017344 1:143832309-143832331 CCATTTGGAGCCGATTATTATGG - Intergenic
922723589 1:227911547-227911569 CCGTCTTGAGATCATGAGTAAGG - Intergenic
1066202546 10:33155899-33155921 CTTTTTGGAGACAATGTTTAAGG + Intergenic
1074598140 10:114886319-114886341 CACTTTGGAGTCCATGATTGTGG + Intronic
1082195993 11:49306509-49306531 TGGTTTGGAGACTTTGATTAAGG - Intergenic
1084299329 11:68236252-68236274 TCCTTTAGAGACCATGATTCTGG + Intergenic
1086259248 11:84917834-84917856 CCATTTGGAGACCATACTAAAGG + Intronic
1088934557 11:114386385-114386407 CCGTATGGAAAACGTGATTAAGG + Intergenic
1093166001 12:15804943-15804965 CCGTGTAGAAACCATGAGTAAGG - Intronic
1115401960 14:32971768-32971790 CCGTTTGGAGACCATGATTATGG - Intronic
1118907631 14:70034020-70034042 CCTTTTGGGGACCAGGAGTAAGG - Intergenic
1121398378 14:93648376-93648398 CAGTTTGGAGACCATGTTAGCGG + Intronic
1124900844 15:33821005-33821027 CCTTTTGGATACCATAATTGTGG - Intronic
1126220878 15:46211340-46211362 CCATCTGGAGACCATCATTCTGG + Intergenic
1145081742 17:19900004-19900026 GCCTTTGGAGCCCATGATTTAGG - Intergenic
1146676036 17:34774491-34774513 GCGCTTGGAGACTTTGATTAAGG - Intergenic
1147028497 17:37609688-37609710 CCGTTTGAAAACCATGATCGCGG + Intergenic
1151491136 17:74432744-74432766 CCTCTTGGAGACCCCGATTATGG - Intronic
1153536032 18:6102365-6102387 GAGTTTGGAGACACTGATTAAGG - Intronic
1168271817 19:55254257-55254279 CCGTTTGAAAACCATGAGTCTGG + Intronic
926844207 2:17116270-17116292 ACCTTTGAATACCATGATTACGG + Intergenic
935182767 2:100705232-100705254 CAGAGTGGAGACCATGAATAAGG + Intergenic
936477413 2:112851545-112851567 CTTTTTGGAGACCAGGATTCAGG + Intergenic
937583307 2:123515244-123515266 CTGCTTGCAGACCATGATTTGGG - Intergenic
942141350 2:172980350-172980372 CTGTTTGGAGAACAAGATTTAGG + Intronic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
1172453070 20:35042487-35042509 CTGTTTTCAGAGCATGATTAGGG + Intronic
1172948260 20:38704974-38704996 CTGTTTCGTGACAATGATTATGG - Intergenic
956540590 3:70333789-70333811 CCATTTGGAGACCATTACTATGG - Intergenic
961052161 3:123756112-123756134 CAGATTGGAGACCATAATTTTGG + Intronic
961144111 3:124579949-124579971 CCCTTTGGAGACCATGTTTCTGG - Intronic
965353032 3:167639229-167639251 TTTGTTGGAGACCATGATTATGG + Intronic
967757573 3:193187407-193187429 CAGTCTGAAGGCCATGATTAGGG - Intergenic
967971188 3:195000829-195000851 CAGTTTTGAGACCAAGATAATGG + Intergenic
978126381 4:105140906-105140928 CCTTTTGGAGATTCTGATTAAGG - Intergenic
983392757 4:167154337-167154359 CTGTTTTGGGACCAGGATTACGG + Intronic
984861994 4:184249222-184249244 CCTTTTGAAGACAAAGATTACGG + Intergenic
1021826627 7:24559712-24559734 TCGTTTGGAGTCAAAGATTAAGG + Intergenic
1031757208 7:125660160-125660182 CCGTTTGCATAACAAGATTAGGG + Intergenic
1045826164 8:106401321-106401343 CCATTTGCAGACCATGCCTATGG + Intronic
1045862834 8:106832113-106832135 CTGTTTAGAGACCATCATTTAGG + Intergenic
1053562630 9:39211573-39211595 CAGGATGGAGACCATGAATAGGG - Intronic
1053828437 9:42049557-42049579 CAGGATGGAGACCATGAATAGGG - Intronic
1054134520 9:61407466-61407488 CAGGATGGAGACCATGAATAGGG + Intergenic
1054602124 9:67137897-67137919 CAGGATGGAGACCATGAATAGGG + Intergenic
1055490017 9:76795312-76795334 CAGTTTGGTGACCATAGTTATGG - Intronic
1056394410 9:86168440-86168462 TCATTTTGAGACCATGAATAGGG + Intergenic
1186214411 X:7283577-7283599 CTGCTTGGAGACCATGAATTGGG + Intronic
1195030177 X:100920053-100920075 ATGTTTGGAGGCCATGAGTAAGG - Intronic
1197971965 X:132123705-132123727 CCCTTGGGAGCCCATGATAAAGG - Intronic
1202101319 Y:21310508-21310530 CCGGTTGGAGACCAGGGTTTGGG + Intergenic
1202187200 Y:22197668-22197690 CCGGTTGGAGACCAGGGTTTGGG + Intergenic
1202204160 Y:22388728-22388750 CCGGTTGGAGACCAGGGTTTGGG - Intronic
1202241059 Y:22770551-22770573 CCGGTTGGAGACCAGGGTTTGGG - Intergenic
1202394045 Y:24404294-24404316 CCGGTTGGAGACCAGGGTTTGGG - Intergenic
1202476740 Y:25265798-25265820 CCGGTTGGAGACCAGGGTTTGGG + Intergenic