ID: 1115408688

View in Genome Browser
Species Human (GRCh38)
Location 14:33048368-33048390
Sequence GTGTAGCCCTTAAGGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115408680_1115408688 17 Left 1115408680 14:33048328-33048350 CCTCCTAGAGGATCAGCATTGTA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1115408688 14:33048368-33048390 GTGTAGCCCTTAAGGACAAAGGG 0: 1
1: 0
2: 2
3: 6
4: 87
1115408682_1115408688 14 Left 1115408682 14:33048331-33048353 CCTAGAGGATCAGCATTGTAGGG 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1115408688 14:33048368-33048390 GTGTAGCCCTTAAGGACAAAGGG 0: 1
1: 0
2: 2
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115408688 Original CRISPR GTGTAGCCCTTAAGGACAAA GGG Intronic
904406759 1:30295978-30296000 GGGAAGCCCTAAAGGAAAAAGGG + Intergenic
908481080 1:64540129-64540151 ATCTATCCATTAAGGACAAAGGG - Intronic
909350671 1:74649634-74649656 GTGAAGCCCTTTTTGACAAATGG - Intronic
913291026 1:117271999-117272021 GTTTGGCCCTTTACGACAAAAGG + Intergenic
919614638 1:199790785-199790807 GGGAAGCTCTTAAGGTCAAACGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921905125 1:220487936-220487958 GTATAGGCATTGAGGACAAATGG + Intergenic
923363181 1:233233363-233233385 GTTTAGCTCTCAAGCACAAAGGG - Intronic
1069413313 10:68174791-68174813 GTGGAACACTTCAGGACAAAGGG + Intronic
1069628541 10:69882943-69882965 TTCTACCCCTTAATGACAAATGG - Intronic
1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG + Intronic
1074310963 10:112323178-112323200 TTGTAGCCCTTAAGAAAGAATGG + Intergenic
1080292105 11:30682601-30682623 ATGTATCCCTTAAGGATAAGGGG + Intergenic
1085713970 11:78855429-78855451 GTGTAACCCTGAAGGAGAGAAGG + Intronic
1089182366 11:116591813-116591835 ATGTAGCCTTAATGGACAAATGG - Intergenic
1089779996 11:120866971-120866993 ATGTAGCCCTTTTGGACAAGTGG + Intronic
1092887640 12:12939013-12939035 GTGTTCCCCTTGAGAACAAATGG - Intergenic
1095770961 12:45956583-45956605 GTGTATCCCTAAAGGACAAATGG + Intronic
1098139469 12:67437111-67437133 GTATAGCCCTTATGGAAAATTGG - Intergenic
1105452007 13:20508274-20508296 GGATAGCCCTCAAGGACAGAAGG + Intronic
1106225080 13:27779372-27779394 GTGTATCCCTTCAGAACAAAAGG - Intergenic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1110269912 13:73578040-73578062 ATGTAGCCCCTATGAACAAAGGG + Intergenic
1110445655 13:75576782-75576804 GTGTAGCCCTAAATGAAATACGG + Intronic
1115408688 14:33048368-33048390 GTGTAGCCCTTAAGGACAAAGGG + Intronic
1117306513 14:54481500-54481522 GTGTATCTCTTAAGGACTTATGG - Intronic
1121358358 14:93233171-93233193 GAGGAGTCCTTAAGAACAAATGG + Intergenic
1125494231 15:40175900-40175922 GCTTAGCCCTGAAGGAGAAATGG - Intronic
1132024424 15:98392747-98392769 GTGTAGGCATGAAGGAGAAAAGG - Intergenic
1142787477 17:2235444-2235466 GCATAACCCTTAAGTACAAACGG + Intronic
1148020473 17:44549873-44549895 GATTAGCCCTCAAGGACAGAGGG + Intergenic
1150998463 17:70346391-70346413 GTGTAGTCCCTAAAGACAGAGGG - Intergenic
1153325167 18:3811167-3811189 GTGTAGACTGTAATGACAAAGGG + Intronic
1161717796 19:5886601-5886623 GTGTGGCCCTTGTGGACACAGGG + Intronic
1161782780 19:6304441-6304463 GTTGAGCCCTTAATGACAAGAGG - Intergenic
1165691688 19:37868603-37868625 GTTTAGCCCTTAGGGAAGAAAGG + Intergenic
925787476 2:7446856-7446878 GTGTCTCCCTTAAGGGCAAAGGG - Intergenic
926878567 2:17514459-17514481 GTGTAGAAGTTAAGGACATAAGG + Intronic
933544121 2:83688314-83688336 GTGTTTCGCTTAATGACAAATGG - Intergenic
935594876 2:104870568-104870590 GTTTAGCTCTTCAGGACACAAGG - Intergenic
935896385 2:107742398-107742420 GGTTAGGCCTTAAGGACACATGG - Intergenic
937652140 2:124331121-124331143 GTGTTGTCATTAAGGACATATGG - Intronic
938068666 2:128295123-128295145 CAGTAGCCCTTCAGGACAGAGGG - Intronic
940204679 2:151190035-151190057 TTGTAGCACATAAGAACAAATGG + Intergenic
941661781 2:168202869-168202891 TTGTTGCTCTTAAGGGCAAATGG - Intronic
942618982 2:177827144-177827166 ATGTAGCACTTAAGGATAATGGG - Intronic
1168948691 20:1781942-1781964 ATGTAGACCTTGCGGACAAAGGG - Intergenic
1169425345 20:5492580-5492602 GTGCTGCCCTTAAAGAGAAACGG - Intergenic
1172939143 20:38642768-38642790 ATATAGCCAGTAAGGACAAAGGG - Intronic
1173454508 20:43191548-43191570 CTATAGCCCTTAGGGACAATTGG + Intergenic
1177721350 21:24910750-24910772 TTGAAGCCCTCAAGAACAAATGG + Intergenic
1182229210 22:28824224-28824246 TTTTATCCCTTAATGACAAAAGG - Intergenic
949327952 3:2888323-2888345 GTTTAGCCCTTAGGGAAGAAAGG - Intronic
951656504 3:25014798-25014820 GTGTGGCCCTGAAGGAAATAAGG + Intergenic
951862577 3:27270261-27270283 GAGCAGCCCTCAAGGATAAAAGG + Intronic
953829409 3:46282646-46282668 GGGTAGCCCTAAAGGACAAGTGG - Intergenic
954519244 3:51208687-51208709 GTGTAACACTTAAGTTCAAAGGG - Intronic
954877687 3:53813481-53813503 GTGTAGCCCTTTAGGAGAAATGG - Exonic
961626282 3:128266097-128266119 TTGAAGGCCTTAAGAACAAAAGG - Intronic
968248650 3:197183412-197183434 GTGTAGGTCTTTAGCACAAAAGG - Intronic
970421592 4:15910235-15910257 GTTTAGCCCTTAGGGAAGAAAGG - Intergenic
971481075 4:27115643-27115665 ATGTGGCCCTGAAGGACAAAAGG - Intergenic
973965105 4:56153800-56153822 GTGAAGCCCTGAGGGAGAAAAGG - Intergenic
980489848 4:133510578-133510600 GTATTGCCATTCAGGACAAAGGG + Intergenic
982000474 4:151016661-151016683 GTGTATCCTTTGAGGTCAAAGGG + Intergenic
989140893 5:38200323-38200345 GTGTGGCCCTGAAGGACAATAGG + Intergenic
993092240 5:83440789-83440811 ATGTATCCCTTAAGAATAAAGGG - Intergenic
994196683 5:96930123-96930145 GTTTAGCCCTTAGGGAAGAAAGG - Intronic
996942000 5:129019131-129019153 GTGTAGCACATAAAGACAATGGG - Intronic
997839445 5:137225897-137225919 GTCTAGCCCTCAAGGACACTAGG + Intronic
998376025 5:141691383-141691405 GCGTAGCCCTAAAGGACAGTGGG - Intergenic
999626910 5:153530701-153530723 GGGCAGCCCTCAAGGACATAGGG - Intronic
1000101468 5:158021122-158021144 GTGCAGTCCTCAATGACAAATGG - Intergenic
1001759479 5:174195360-174195382 GTGGAGCCCTTGAGCAGAAATGG + Intronic
1001934688 5:175695751-175695773 GTGTAGACCTCAAGGAGAAGGGG + Intergenic
1005830343 6:29665986-29666008 GCTTAGCCCTGAAGGAAAAATGG - Intronic
1006649040 6:35535870-35535892 GTGAACTCCTGAAGGACAAAAGG - Intergenic
1008381319 6:50842210-50842232 TTCTAGCCCTGAAGGTCAAATGG - Intronic
1013392617 6:109701940-109701962 GTAAAGCCCTGAAGGTCAAATGG + Intronic
1014767162 6:125420258-125420280 ATGTAGGCCTTGAAGACAAAAGG + Intergenic
1020921999 7:14277846-14277868 GTGCAGCCTTTATGGAAAAATGG - Intronic
1022284995 7:28948516-28948538 GTGGAGCCCTTCCTGACAAATGG + Intergenic
1026529263 7:71183293-71183315 GTGTAGCTCTTGAAGACAGAAGG + Intronic
1031537897 7:122957861-122957883 GGGTGGCCCTAAAGGATAAAAGG - Intergenic
1034163080 7:149006605-149006627 GTGTGGCACTGAAGGACAAGAGG + Intronic
1034478050 7:151300100-151300122 GGGAAACCCTGAAGGACAAATGG - Intergenic
1034822704 7:154231870-154231892 TTGTAGCCCTTGAGGTCAACCGG + Intronic
1036719711 8:11162317-11162339 GTGTAGCTCTTCAGGGCCAAGGG - Intronic
1038160581 8:25033492-25033514 GTGTATCCCTAAATGACAGAAGG - Intergenic
1038466217 8:27766293-27766315 CTGGAGCCCTGAAGGACAAAGGG + Intronic
1050825845 9:9944564-9944586 GTGAAGACCTGAAGGAAAAAAGG + Intronic
1055860090 9:80739103-80739125 GTGAAGACCATAAGGAGAAAGGG + Intergenic
1058816792 9:108691789-108691811 GGGTAAGCCCTAAGGACAAAGGG + Intergenic
1189699569 X:43703474-43703496 TTGTATCCCTTCTGGACAAAAGG - Intronic
1197028858 X:121789318-121789340 GTGTAGCTATTAAGAACACATGG + Intergenic
1197595286 X:128456713-128456735 GTCTAGTCCTTGAGGATAAAGGG + Intergenic