ID: 1115410444

View in Genome Browser
Species Human (GRCh38)
Location 14:33068083-33068105
Sequence CTATGCAAAGCACCATGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115410441_1115410444 21 Left 1115410441 14:33068039-33068061 CCTATCTTACTCAGTTTGGTTCA 0: 1
1: 0
2: 1
3: 10
4: 159
Right 1115410444 14:33068083-33068105 CTATGCAAAGCACCATGCTAGGG 0: 1
1: 0
2: 4
3: 30
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115410444 Original CRISPR CTATGCAAAGCACCATGCTA GGG Intronic
900230692 1:1555602-1555624 CTGTGCACAGCACGATGCTCTGG + Intronic
900908403 1:5576889-5576911 CTATGCAAATCACATTTCTAGGG + Intergenic
903962663 1:27066507-27066529 ATGTGCCAGGCACCATGCTAAGG - Intergenic
904323708 1:29713206-29713228 GTATGCAGAGCACCATGGGAAGG + Intergenic
904960559 1:34329466-34329488 TTGTGCCAAGCACCGTGCTAAGG - Intergenic
906150352 1:43583904-43583926 GAATGCAAAGCATCAAGCTAAGG - Intronic
907727911 1:57037169-57037191 ATTTGCAAATCACCATGCTGGGG + Intronic
910380124 1:86617603-86617625 CTATGGAAAACAGCATGATAAGG - Intergenic
915974520 1:160376210-160376232 CTTTACAAAGCACCAGGCTAAGG + Intergenic
916337518 1:163690192-163690214 CTATGGAATGTACAATGCTATGG + Intergenic
916423195 1:164655440-164655462 TTCTACAGAGCACCATGCTATGG + Intronic
917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG + Intronic
920118687 1:203639334-203639356 ATATGCCAAGCACTATGTTAAGG + Intronic
1065671768 10:28127258-28127280 CTGTGCAAGGCACCGTTCTAAGG + Intronic
1065863997 10:29897784-29897806 CTTTGCCAACCACCATTCTAGGG + Intergenic
1067158531 10:43802909-43802931 ATATGCAAAGCAGCAGGCTAGGG - Intergenic
1067981704 10:51094026-51094048 CTGTGCCAAGCACCATTCTGGGG - Intronic
1068344483 10:55755910-55755932 CTATGCAAAACTCCAGGATATGG - Intergenic
1068595214 10:58895876-58895898 TGATGCAGAGCACCATCCTAGGG - Intergenic
1069001768 10:63274777-63274799 ATGTGCAAGGCACCATGCTTTGG + Intronic
1071434219 10:85632052-85632074 CTATGCCAGACATCATGCTAGGG - Intronic
1072305944 10:94107341-94107363 GTATGTAAAGCACCAAGCAAGGG - Intronic
1072346380 10:94511589-94511611 CTATGCAAGACATCATGATATGG - Exonic
1072421425 10:95292791-95292813 CTATGCCAAGCACTGTGCTGGGG - Intergenic
1073543714 10:104332185-104332207 CTGAGCAAAGCCCCATTCTAGGG - Intronic
1074461462 10:113641836-113641858 ACATGCAAAGCCCCATGCTGAGG + Intronic
1074556877 10:114499647-114499669 CTATGCAGATCACCATGAGATGG + Intronic
1074952082 10:118347053-118347075 CAATGCTCAGCACTATGCTAAGG + Intergenic
1079144977 11:17842856-17842878 TTATGAAAAGCAGCATGCTGTGG + Intronic
1079449014 11:20583139-20583161 CTGTTCTAAGCACCATCCTAAGG - Intergenic
1080859377 11:36140016-36140038 TTGGGCTAAGCACCATGCTAGGG + Intronic
1081710060 11:45210575-45210597 CTTTGCAAAGCACCTTCCCATGG - Intronic
1082086572 11:48055211-48055233 ATGTGCCAGGCACCATGCTAGGG - Intronic
1083146854 11:60766453-60766475 CTATGCTAAGCACTGTGCTGGGG - Intronic
1083237399 11:61360347-61360369 CTTTGCAGAGCCCCATTCTAAGG + Intronic
1083778698 11:64907047-64907069 GTATGTAAAGCACCATGCTAGGG - Intronic
1084153105 11:67300286-67300308 CTGTGCCAAGCCCCTTGCTAAGG - Intronic
1085744438 11:79102600-79102622 GTGTGCAAGGCACCATGCCAAGG - Intronic
1085912361 11:80842836-80842858 TTCTGCAAAGCAACATGATATGG + Intergenic
1089020502 11:115209305-115209327 CTATTGAAAGCAAAATGCTAGGG - Intronic
1089880064 11:121765123-121765145 CTGTGCAAGGCACCACACTAGGG - Intergenic
1089918688 11:122185712-122185734 CTATGCTAAGCACTATTCTAGGG - Intergenic
1093546872 12:20359104-20359126 GTATGCAAAATACCATGCCAGGG + Intergenic
1098018073 12:66127373-66127395 CCTTCAAAAGCACCATGCTAAGG + Intronic
1099150305 12:79103301-79103323 CTATGCAAAGCCCAAAGATAAGG - Intronic
1100194551 12:92229536-92229558 CTATGTAAAGCAGCATACTTAGG - Intergenic
1100586391 12:95984229-95984251 CTATACAAAGCAGCATGGTGTGG + Intronic
1101554500 12:105795665-105795687 ATATGCCAGGCACCATGCTAAGG - Intergenic
1101657073 12:106731932-106731954 TTATGCCAAGCACTAGGCTAAGG + Intronic
1101830162 12:108250832-108250854 CTGTGCAAAGCATGATGCTCAGG - Intergenic
1102336208 12:112082616-112082638 CTATATAAAACACCATCCTAGGG + Intronic
1102689039 12:114746171-114746193 ATGTGCCAGGCACCATGCTAGGG + Intergenic
1104056184 12:125232254-125232276 CTAAGCAAAGAACCATGAGATGG - Intronic
1104196498 12:126544205-126544227 ATAAGCCAAGCACCATGCTTAGG - Intergenic
1106339819 13:28818002-28818024 CTCTGCAAGGCACCATGCCCTGG - Intergenic
1106376174 13:29190481-29190503 CTCTGCTAAGCCCCATGCTATGG + Intronic
1106568101 13:30904565-30904587 CTATGCAAAGAGAGATGCTATGG - Intergenic
1108120318 13:47178798-47178820 CTATGCATTGAACCATGGTATGG - Intergenic
1110155520 13:72312171-72312193 ATATGCCAGGCACTATGCTATGG + Intergenic
1110789297 13:79569622-79569644 CTATGCAAAGGACCAGGAAAGGG + Intergenic
1115114976 14:29869680-29869702 GTGTGCCAAGCACTATGCTATGG + Intronic
1115117487 14:29899771-29899793 ATGTGCAAAGCACTATGATATGG + Intronic
1115410444 14:33068083-33068105 CTATGCAAAGCACCATGCTAGGG + Intronic
1117464053 14:55974716-55974738 ATGTGCCAAGCACCAGGCTAAGG + Intergenic
1118002277 14:61534522-61534544 CTATGCAAAACACCATCCAATGG - Intronic
1119068374 14:71553876-71553898 TTATACAAAACACTATGCTAAGG - Intronic
1121078990 14:91092295-91092317 CTATTCTAAGCACCATGGTGGGG - Intronic
1121868354 14:97384001-97384023 CTATGCAAAGCCATGTGCTATGG + Intergenic
1121924613 14:97916216-97916238 CTATGCAAACCGCAATGCTGTGG - Intergenic
1124854883 15:33378119-33378141 CTATGCCAAGCATTATGCTAAGG - Intronic
1125073757 15:35588431-35588453 CAATGGAAAGCAACATGATAGGG + Intergenic
1128645556 15:69376381-69376403 CTATGCAAAACACTTTGCTAAGG + Intronic
1131614982 15:94006780-94006802 CTATGCAATTCACCATGTAACGG + Intergenic
1131960028 15:97780454-97780476 CAAAGCAAAGAACTATGCTATGG + Intergenic
1133662219 16:7929239-7929261 GTGAGCAAAGCACCAAGCTATGG - Intergenic
1137497216 16:48979825-48979847 ACATGCCAGGCACCATGCTAAGG + Intergenic
1138291793 16:55854230-55854252 CTAGGCACAGTAGCATGCTAGGG - Intronic
1142311936 16:89319303-89319325 CTGGGCAAAGCACCAAGCTAGGG - Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1144049505 17:11486477-11486499 ATATGCAAAGTACTATGCTAAGG + Intronic
1144581793 17:16463397-16463419 CTGTGCAGGGCACCAAGCTAGGG - Intronic
1149081499 17:52663871-52663893 TTATGCAAAGCTCCTTTCTAAGG + Intergenic
1149479174 17:56987769-56987791 CTATGCCAAGGACCTGGCTATGG + Exonic
1150147293 17:62779631-62779653 GTATGCAAAGCATTGTGCTATGG + Intronic
1150355175 17:64477264-64477286 CTAGGCAAATCACCATCCAAGGG - Intergenic
1152669844 17:81596695-81596717 CTATGCAAACCACCCCGCCATGG + Intronic
1155038073 18:22042114-22042136 CTGTGCCAAGCACTGTGCTAGGG - Intergenic
1157127064 18:44966612-44966634 CTGTGCTCAGCACCATCCTAAGG - Intronic
1158260188 18:55597949-55597971 CTATGAAAAGCACTATGCAAGGG + Intronic
1158269416 18:55696806-55696828 ATATGCAAATCCCCAGGCTAGGG - Intergenic
1160118847 18:76109002-76109024 CTAGCCAAAGCACCAGGCTAGGG - Intergenic
1162752384 19:12836656-12836678 ATGTGCTAGGCACCATGCTAAGG + Intronic
1165343156 19:35226557-35226579 ATATGCCAAGCTCCATTCTAGGG - Intronic
1167095967 19:47375324-47375346 CCATGCCCAGCACCATGCGAGGG + Intronic
1167251454 19:48400434-48400456 CTCTGAAAAGTACCATGCCAAGG - Intronic
1167807181 19:51796096-51796118 CTCTGCAAAGCAGAATGCTCAGG - Intronic
928082050 2:28320316-28320338 ATGTGCAGAGCACCATGCTAAGG + Intronic
935419496 2:102852830-102852852 CTCTGCAAAGCACCAGCCTCTGG + Intergenic
937680557 2:124640078-124640100 GTATGCAGAGCACTATGTTAGGG - Intronic
941441543 2:165543861-165543883 ATATGCAAAGCACTTTTCTAGGG + Intronic
941892742 2:170598572-170598594 TTATACTAAGAACCATGCTATGG + Intronic
943362443 2:186937269-186937291 CTATGCCAAGCCCTATTCTAGGG + Intergenic
943797201 2:192011337-192011359 CTGTGCAAAACACTGTGCTAGGG + Intronic
947373454 2:229471723-229471745 ATTTGCAAAGCACAGTGCTAAGG + Intronic
949050035 2:241892768-241892790 CTTTGCAAAGCCCCAGGCTGCGG - Intergenic
1172663168 20:36581263-36581285 CTCTGCACAGCTCCATGCTGAGG - Intronic
1173347617 20:42215409-42215431 ATATGCCAAAGACCATGCTAGGG - Intronic
1173846153 20:46189995-46190017 GTTTGCAAACCACTATGCTAGGG + Intronic
1175064211 20:56271777-56271799 CCATGGAAAGCCCCCTGCTATGG + Intergenic
1175434220 20:58931350-58931372 CAATTCAAAGCACCCTGCTATGG + Intergenic
1177125907 21:17192702-17192724 CTATCATAAGCACAATGCTAAGG - Intergenic
1178160299 21:29904723-29904745 CTATGGAAAGCACCCTACCAAGG + Intronic
1179606426 21:42518532-42518554 CTATACACAGCTCCATGCCAAGG - Intronic
1180886074 22:19244859-19244881 TTGTGCCAGGCACCATGCTAGGG + Intronic
1183576305 22:38692137-38692159 CTGTGCCAAGCACTATGATAAGG + Intronic
1184351234 22:43945512-43945534 ATGTGCCAAGTACCATGCTACGG - Intronic
1184677466 22:46051592-46051614 GGATGCAAAGCACCAGGCGATGG - Exonic
949513833 3:4789406-4789428 TTTTGCAGAGCACCATGCTTGGG + Intronic
950172652 3:10850393-10850415 CTATGCCAGGCACCAGGCTGGGG + Intronic
951126838 3:18994903-18994925 ATATGTAAAGCACCTAGCTAAGG - Intergenic
951681390 3:25298549-25298571 CTATGCAAATCACCATCCTGGGG - Intronic
954116675 3:48470455-48470477 GTATGCCAAGCACCGTGCCAGGG + Intronic
955142373 3:56282049-56282071 CTATGCAAAGCACTTTGCACAGG - Intronic
955145707 3:56316986-56317008 GTGTGCTAAGCACTATGCTAAGG + Intronic
955740003 3:62080490-62080512 GCATGAAAAGCAGCATGCTAAGG - Intronic
955922761 3:63974675-63974697 ACATGCCAGGCACCATGCTACGG - Intronic
956914363 3:73855541-73855563 CTCTGCAGAGCACTTTGCTAAGG + Intergenic
957951842 3:87137309-87137331 CTCTCCAAAACACTATGCTAAGG - Intergenic
958999801 3:100950205-100950227 CTCTGCCAGGCACCGTGCTAGGG - Intronic
961620443 3:128219740-128219762 ACATGCCAAGCACTATGCTAAGG - Intronic
962313906 3:134346136-134346158 CTATGCCAGGCATCATGCTAAGG + Intergenic
962616935 3:137135684-137135706 CAAGGCAAAGCACCATGGTCAGG - Intergenic
964401982 3:156309483-156309505 GTGTGCATAGCACCATGATAGGG + Intronic
966580785 3:181560162-181560184 CTATGCCAGGCACCATGCTAGGG + Intergenic
967108395 3:186272050-186272072 ATGTGCCAGGCACCATGCTAGGG - Intronic
969108785 4:4828457-4828479 CTCTGCACAGCACCTTTCTAGGG + Intergenic
969197156 4:5572171-5572193 CTATACAAAGCACCAAGTTGGGG + Intronic
969527973 4:7713703-7713725 TTAAGCAATGCACCCTGCTAAGG - Intronic
975859716 4:78663782-78663804 CTTTGGAAACCACCATGTTAAGG - Intergenic
976262862 4:83162550-83162572 ATATGCCAAGCACCATTTTAAGG - Intergenic
977297408 4:95226202-95226224 CTAAGAAAAGCACCAGGCCATGG + Intronic
977415517 4:96727930-96727952 CTATGCAGAGGACCATGTCAAGG + Intergenic
977493943 4:97750862-97750884 GTCCGCAAAGCACCATGCTTAGG - Intronic
978204017 4:106058108-106058130 ATTTGAAAGGCACCATGCTAGGG + Intronic
978550019 4:109915354-109915376 CTCTGCTAAGCACCATGCTTTGG - Intronic
978768619 4:112430921-112430943 CTATTCACAGCACCATACTTCGG + Exonic
980857401 4:138455958-138455980 CTCTGCAAAGAACCCTTCTATGG - Intergenic
981125425 4:141100630-141100652 CTATACAAAGAGGCATGCTAGGG + Intronic
981573822 4:146182518-146182540 TTATGCAAAGCATTCTGCTAAGG - Intronic
981972804 4:150685754-150685776 CTGTGCAAAACACTATGCTAGGG + Intronic
985363765 4:189204272-189204294 CTATGAGAAGCACCATGGGAGGG + Intergenic
990058905 5:51622100-51622122 CTTTGCAAAGCTCCATTCTAGGG + Intergenic
991284882 5:64961849-64961871 ATATGTCAAGCACTATGCTAGGG - Intronic
991411503 5:66350385-66350407 CCATGCCAGGAACCATGCTAGGG - Intergenic
993184377 5:84598169-84598191 CAAGACAAAGCCCCATGCTAAGG + Intergenic
997720643 5:136076040-136076062 GTATGCCAAGCACTATGCTAGGG + Intergenic
998503054 5:142650225-142650247 CTATGCCAGGCACCATGCTAGGG + Intronic
998553737 5:143102786-143102808 CTGTACAAAGCACAATGATAAGG - Intronic
998714276 5:144864690-144864712 CTATGCTAGGGACTATGCTAGGG - Intergenic
999102207 5:149036029-149036051 CTGTGCCAGGCACCATTCTAAGG + Intronic
999675771 5:154000938-154000960 TTATGCCAGGCACCATGCTAAGG + Intronic
999933144 5:156455609-156455631 CTATGCAAGGCTCCAGGCAAGGG - Intronic
1000783838 5:165518560-165518582 CTATTCAAAAAATCATGCTAGGG - Intergenic
1001956668 5:175852507-175852529 CTGTGCCAGGCACCATGCAAAGG + Intronic
1002335705 5:178476770-178476792 CTGTGCCAGCCACCATGCTAGGG + Intronic
1004091995 6:12513131-12513153 AGATGCAGGGCACCATGCTATGG + Intergenic
1009353696 6:62712927-62712949 ATTTGCAAAGCACGATGCTGAGG + Intergenic
1017543146 6:155423548-155423570 GTCTGCATAGGACCATGCTAAGG - Intronic
1018071691 6:160170285-160170307 CTATTCAGAGCATCATGCTTGGG + Intergenic
1018281392 6:162189577-162189599 CTATGCTAAGCACCAAAGTATGG + Intronic
1020339144 7:7090427-7090449 CTATGCCAGGTACCATTCTATGG - Intergenic
1022928238 7:35078931-35078953 GTATGTCAGGCACCATGCTATGG - Intergenic
1023001177 7:35809371-35809393 ATATGCCAGGCATCATGCTAAGG - Intronic
1023109250 7:36793447-36793469 CTGTGCAAAGCACTGTGCCAAGG - Intergenic
1027659283 7:80969823-80969845 ATATGCAAAGCACCCTGTGAAGG - Intergenic
1028374050 7:90126660-90126682 GTATGTCAGGCACCATGCTATGG + Intergenic
1029296104 7:99541858-99541880 CTATGAAAAACACCTTGCTCGGG - Intergenic
1029897957 7:104006289-104006311 ATATGCCAAGCATCGTGCTAGGG + Intergenic
1031460341 7:122040935-122040957 CTATGCCAAGCGCCATGCAGTGG + Exonic
1032993003 7:137414407-137414429 ATGTGCAAAGCATTATGCTAGGG - Intronic
1033311863 7:140267594-140267616 CTCTGCATAGCACCATGCCTGGG + Intergenic
1034747802 7:153538604-153538626 CTATGCAAAGCACTATTCTGGGG + Intergenic
1037924127 8:22831516-22831538 ATATACTAAGCACCATGCTAAGG + Intronic
1038246788 8:25865563-25865585 ATATGCCAAGCACCGTGCTGAGG - Intronic
1041729588 8:61051198-61051220 CTTTGCACAGCACCATGCTGTGG - Intergenic
1043403889 8:79911219-79911241 TAATGCAAGGTACCATGCTAAGG + Intergenic
1047310038 8:123684301-123684323 CTATGCATGGCTCCATGTTAAGG - Intronic
1047314647 8:123721568-123721590 CTACACAAAGCACCATGCAAAGG - Intronic
1047527386 8:125645218-125645240 GTGTGCCAGGCACCATGCTAAGG + Intergenic
1047819837 8:128506756-128506778 CTGTGCCAAGCACTATGCTGGGG - Intergenic
1048366825 8:133745601-133745623 CTGTGCCAGGCACCATGCTGAGG - Intergenic
1051809744 9:21034972-21034994 CTATGCCAAGCACTGTACTAGGG - Intergenic
1052512344 9:29438002-29438024 CTATGCAAGGCAACAAGTTAAGG + Intergenic
1056553554 9:87671156-87671178 AGATGCAAAGCACCTTGCTGCGG + Intronic
1058560166 9:106219933-106219955 CTTTCCCAAGCAACATGCTAGGG + Intergenic
1059632783 9:116142368-116142390 CTGTGCCAGGCACCATGCCAAGG + Intergenic
1186802393 X:13106141-13106163 CCCTGCGAAGCACCATGCTAGGG + Intergenic
1187946576 X:24431972-24431994 CTGTGCCAGGCACCTTGCTAGGG + Intergenic
1188741102 X:33783132-33783154 ATATGCAGAGTACCATGCTAGGG - Intergenic
1189454273 X:41170646-41170668 GTATGTAAGGCATCATGCTAGGG + Intronic
1190481144 X:50878129-50878151 CTTTACAAAGCATCATGCTAAGG + Intergenic
1194851530 X:98875827-98875849 CTTTGCACAGCACCATGCATTGG - Intergenic
1195293003 X:103447133-103447155 CTATGGCAACCACCATGCTCAGG - Intergenic
1195454603 X:105053391-105053413 CTATGCCAGGCACCATGCTATGG + Intronic
1195724559 X:107900912-107900934 CTGTGCAAAGCATTATGCTAAGG - Intronic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1197334164 X:125191627-125191649 CTAGGCAAAGCACTGTCCTAAGG - Intergenic
1200081291 X:153577975-153577997 CTAGGCAAAGCACAGTGCTTCGG - Intronic