ID: 1115418453

View in Genome Browser
Species Human (GRCh38)
Location 14:33164874-33164896
Sequence CCTTCTGTACTGGTGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115418449_1115418453 -4 Left 1115418449 14:33164855-33164877 CCTGTCAATTCACTGACTTCCTT 0: 1
1: 0
2: 0
3: 7
4: 251
Right 1115418453 14:33164874-33164896 CCTTCTGTACTGGTGAGACAGGG 0: 1
1: 0
2: 0
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115418453 Original CRISPR CCTTCTGTACTGGTGAGACA GGG Intronic
902700312 1:18167760-18167782 CCTGCTGTACAGGGGAGAGAAGG + Intronic
905133272 1:35777720-35777742 ATTTCTGTACTGGTGAGTGATGG + Intergenic
905809916 1:40904674-40904696 CCTTCTTTTCTCTTGAGACAGGG - Intergenic
907667946 1:56449816-56449838 CCTTCTCTGAGGGTGAGACATGG + Intergenic
907983220 1:59505432-59505454 CCCTCTCTGCTGGTAAGACATGG + Intronic
910749799 1:90616649-90616671 CCAGCTGTAATGGTGAGATAAGG + Intergenic
911057363 1:93720438-93720460 CCTTCTTCACTGCTGATACAGGG + Intronic
911579405 1:99617772-99617794 CCTGTTGTACTGGTCACACAAGG - Intergenic
913135768 1:115887605-115887627 TCTGCTGTACTGGTGAGGAAGGG + Intergenic
917867158 1:179207652-179207674 CCTATTTTACTGGTGAGAAAAGG + Intronic
920211139 1:204329310-204329332 CCCTGTGGACTGGTAAGACATGG - Intronic
920392396 1:205616619-205616641 CCTTCTGTACTGAACAGTCATGG - Exonic
920725757 1:208433411-208433433 CCAGCTGTGATGGTGAGACATGG - Intergenic
922714174 1:227858154-227858176 GCTCCTGTGCTGGTGAGACCTGG + Intergenic
923008347 1:230069007-230069029 CCTGGTGTGCTGGTGAGACCTGG + Intronic
923085705 1:230702224-230702246 TCTTCCGTCCTGGTGACACAGGG - Intergenic
1064074391 10:12257302-12257324 CCTTCTGTCCTGATGACACTGGG + Intergenic
1067453966 10:46400985-46401007 CCTTCTGTACTGATGAGAATGGG - Intergenic
1067633235 10:47983642-47983664 CCTTCTGTACTGATGAGAATGGG + Intergenic
1070796762 10:79221457-79221479 CCTTCTGTACTGAGGAGGGAGGG - Intronic
1074426442 10:113355668-113355690 CCTCTGTTACTGGTGAGACAGGG - Intergenic
1075741933 10:124701317-124701339 CCTTCTGTACTTGTCAGATTAGG - Intronic
1076103126 10:127798333-127798355 CCTCCTGCCCTGGTGAGCCAGGG + Intergenic
1076542043 10:131220649-131220671 CCTTCTCTACAGCTGAGGCAGGG - Intronic
1076932120 10:133538489-133538511 CCTTCTTTACTGGGCAGACACGG + Intronic
1077343945 11:2037870-2037892 CCTCCAGTACTGGGGAGCCATGG + Intergenic
1078543610 11:12230418-12230440 CCTTCTGGAGTGGAGATACAGGG + Intronic
1079504363 11:21136902-21136924 TCTTCTTTACTGGTGAGACTGGG - Intronic
1080412298 11:32037360-32037382 CCTCCTGTACTTGTGAGAGGTGG - Intronic
1083433779 11:62629183-62629205 CCTTCTGTGGGGGTAAGACAGGG - Exonic
1083516760 11:63266390-63266412 TCTTCTGCAGTGGTGTGACAGGG - Intronic
1085623427 11:78054349-78054371 AGTTCTGGACTGGTGTGACAAGG + Intronic
1087715409 11:101602909-101602931 CCTTCTTTGCTGCTGAGCCAGGG - Intronic
1089497586 11:118915623-118915645 CCTCCTGGACTTTTGAGACATGG - Intronic
1202826931 11_KI270721v1_random:93059-93081 CCTCCAGTACTGGGGAGCCATGG + Intergenic
1092387063 12:8043956-8043978 CCTCCTGTTCTGGTGAGTCTTGG - Exonic
1094405124 12:30109100-30109122 CCTTATGTAGTAGGGAGACAGGG - Intergenic
1096805586 12:54139141-54139163 GCTCCTGTCCTGGTGACACACGG - Intergenic
1098361996 12:69663814-69663836 CCTTTTGTATTTTTGAGACAGGG - Intronic
1098678549 12:73321544-73321566 GCTTCTCTACTGGTCAGGCATGG - Intergenic
1100186039 12:92141399-92141421 CCCTCTGTAATGTTGAAACAAGG - Exonic
1100744648 12:97632498-97632520 CCGTCTATACTGCTGTGACAAGG - Intergenic
1102832249 12:116013862-116013884 TGTTCTGTACTGCTGAGAAAGGG + Intronic
1114188564 14:20422791-20422813 CCTGATGTACTCCTGAGACAGGG - Intergenic
1115418453 14:33164874-33164896 CCTTCTGTACTGGTGAGACAGGG + Intronic
1118302822 14:64630518-64630540 CCTACTGTACAGATGAGAAAAGG + Intergenic
1118354145 14:64997805-64997827 CTTTCTGTACCAGGGAGACAAGG - Intronic
1119423010 14:74518784-74518806 CCTGCTGTACTGGTGGGCCCAGG + Intronic
1120393887 14:83943949-83943971 CCTCTTGCATTGGTGAGACATGG - Intergenic
1123183064 14:106487931-106487953 CCTTATTTCCTGATGAGACAAGG + Intergenic
1128600875 15:68994462-68994484 CCTTCTGCACTGGCAAGAGAGGG + Intronic
1133540180 16:6743748-6743770 CCTTCTTTCCTTTTGAGACAGGG - Intronic
1135042880 16:19131338-19131360 GCTTCTATTCTGGTGAGAAAGGG - Intronic
1136555421 16:31004918-31004940 CCTTCTGTCCTGCTGACAGATGG + Intronic
1137633557 16:49965973-49965995 CCTTTTGTAGTGGAGAGGCATGG - Intergenic
1138426718 16:56939065-56939087 CCTTCTGTGCTTGTGGTACATGG + Intronic
1145223502 17:21108140-21108162 CCTTCTGTCATGCCGAGACAGGG - Intergenic
1148006315 17:44433431-44433453 CTTTCTGTACTAGTCAGAAAGGG - Intronic
1148671386 17:49413166-49413188 CCTTATATAATGGTGAGGCATGG - Exonic
1151999292 17:77635321-77635343 CCTCTGGTACTGGTGGGACATGG - Intergenic
1152281193 17:79385757-79385779 CCTTCTGTAATGGAGAGTGATGG - Intronic
1152281238 17:79385979-79386001 CCTTCTGTAATGGAGAGTGATGG - Intronic
1153116655 18:1665270-1665292 CCTTCTGAATTTATGAGACAGGG - Intergenic
1158453726 18:57588547-57588569 GATTTTGTACTGGTGAGACTTGG - Intergenic
1163367517 19:16883960-16883982 CTGTCAGTCCTGGTGAGACAGGG + Intergenic
1165091620 19:33391027-33391049 CCTTCTGGACAGGTGACACCTGG + Intronic
1166560666 19:43730474-43730496 CTGTCTGTACGGGTGAGGCATGG + Exonic
1166834893 19:45661295-45661317 CCTTCTTTTCTTTTGAGACAGGG + Intergenic
929806963 2:45154477-45154499 CCTTCATTACTGGTGAAACGAGG - Intergenic
934546109 2:95217855-95217877 CTTTCTGTTCTGTTGAGACCAGG + Intronic
935944387 2:108271993-108272015 CCTTCTGTAATTGAGAGACCCGG + Intergenic
940469200 2:154072255-154072277 CCTTCTGGACTAGTGCTACATGG + Intronic
941261467 2:163303637-163303659 CTTACTGTACTAGTGAGACTAGG - Intergenic
943748035 2:191482812-191482834 CTTTCTTTCCTGGTGAGATATGG + Intergenic
948643950 2:239392309-239392331 CCTTCTGACCTGGAGAGCCAAGG + Intronic
1170749769 20:19135255-19135277 CCTTCTTTACTGGGGATCCATGG + Intergenic
1171307269 20:24117192-24117214 CATTCTGTGCTGATGAGAGAGGG + Intergenic
1172949400 20:38713041-38713063 TCTTCTGTTCTTTTGAGACAGGG - Intergenic
1173837619 20:46136191-46136213 CACTCTGAACTGGGGAGACAGGG + Intergenic
1173963947 20:47097572-47097594 CCTTCTGTTTTTTTGAGACAAGG + Intronic
1175709166 20:61205564-61205586 CCTTTTATTCTGGTTAGACATGG + Intergenic
1176258621 20:64167075-64167097 CACTCTGCACTGGGGAGACAGGG + Intronic
1178494536 21:33075764-33075786 TGGTCTGTCCTGGTGAGACAAGG + Intergenic
1180641697 22:17304244-17304266 CCTCCTGTCCTGCTGGGACAAGG - Intergenic
1184450656 22:44580590-44580612 CCTTCTGCACTGGGAAGGCACGG - Intergenic
1185051229 22:48555341-48555363 CTTGCTCTGCTGGTGAGACAGGG - Intronic
952327821 3:32336816-32336838 CCTTCTGTTTTGGTGAAGCATGG - Intronic
954493630 3:50931111-50931133 CCGTCTGTAGTGGGGAGGCATGG - Intronic
955370912 3:58351053-58351075 CTTTCTGTGCTGGGGAGACTGGG - Intronic
958983320 3:100751021-100751043 CCTTCTGCACTGCTTAGACAAGG + Intronic
960701172 3:120440830-120440852 CTCTCTGTAATGGTGAGAGAAGG + Intronic
960973242 3:123154093-123154115 CCTCCTGTCCTGGTGAGCCCAGG - Intronic
963016134 3:140825991-140826013 CCTTCTTTACTGGTGAAGTATGG - Intergenic
963093369 3:141508389-141508411 CTTTCTTTACTATTGAGACAGGG + Intronic
963624059 3:147648630-147648652 CCTTCTTTTCTGGCGAGGCATGG - Intergenic
966724774 3:183099461-183099483 GCCTCTGTACTGGGGAGTCACGG - Exonic
975929019 4:79495219-79495241 CATTCTGTGCTCCTGAGACAGGG + Intergenic
983971579 4:173882012-173882034 CCTCCTGTACTGATGCCACATGG - Intergenic
987747462 5:21994717-21994739 GCTTCTGGTCTGGTGAGACTTGG + Intronic
987918884 5:24252142-24252164 CCTTCTGCCCTGTGGAGACAAGG - Intergenic
988922162 5:35953647-35953669 CCTCCTTTGCTGGTCAGACATGG - Exonic
991767638 5:70004517-70004539 GCTTCTGGTCTGGTGAGACTTGG + Intergenic
991846872 5:70879593-70879615 GCTTCTGGTCTGGTGAGACTTGG + Intergenic
992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG + Intronic
993437022 5:87910013-87910035 CCTTCTGTACTGTTAACAGAAGG + Intergenic
996873173 5:128214670-128214692 CATTCTGTACTGCAGAGACTGGG - Intergenic
997993530 5:138566615-138566637 TCATCTGTGCAGGTGAGACACGG - Exonic
998781921 5:145666778-145666800 CCTTCTGTGCTTGTCAAACAAGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1003745395 6:8995874-8995896 TATTGTGTACTGGTGAGATATGG + Intergenic
1005377516 6:25199103-25199125 ACTTCTGTACTGGAGAGGCAGGG - Intergenic
1006922708 6:37637070-37637092 CCTTCTTTACTGCAAAGACAGGG - Exonic
1008447080 6:51605250-51605272 CTTTCAGTCCTGCTGAGACAGGG - Intergenic
1011492786 6:87909975-87909997 CCTTCTGAATTGGAGAGCCAAGG - Intergenic
1014918034 6:127177327-127177349 CCTTCTGTACAGCTAAGAAATGG - Intronic
1016737436 6:147494523-147494545 CAATCAGTACTGGGGAGACAGGG - Intergenic
1020266590 7:6564613-6564635 CTTTCTGGACTGAGGAGACAGGG + Intergenic
1023272572 7:38480529-38480551 CCTTCAGGACTGGTGAGAGGTGG + Intronic
1029115769 7:98236369-98236391 CCTTCTGTCCAGGGGAAACAAGG - Intronic
1030147890 7:106374929-106374951 CCTTCAGCATTGGGGAGACAAGG + Intergenic
1033581522 7:142741453-142741475 CCTTCTATACTGGTGAGTTTTGG + Intergenic
1037747401 8:21657963-21657985 CCTTATGGACTGGTGAGAGAAGG - Intergenic
1038037319 8:23697332-23697354 CCAGCTGTACCTGTGAGACAGGG + Intergenic
1038854887 8:31320289-31320311 CCTTCTGTTCTGGGCAGACTGGG + Intergenic
1039592146 8:38757663-38757685 CACGCTGTACTGGGGAGACAAGG + Intronic
1040750352 8:50698461-50698483 CCTCCTGTACTGGTGGGGGAAGG + Intronic
1045775482 8:105797610-105797632 TTTTCTGTACTGTTGAGGCACGG - Intronic
1046236730 8:111433946-111433968 CATTCTGAACTGGTGTGAGATGG + Intergenic
1047222283 8:122928163-122928185 CCTTCTGTCCTGGTGGGAGTGGG - Intronic
1049848869 8:144820191-144820213 CCTCCTTTGCAGGTGAGACACGG - Intergenic
1051880078 9:21831036-21831058 CCTCCTGTACTTGTGGTACATGG + Intronic
1052813613 9:33083119-33083141 CATCCTGGACTGGTGAGCCAGGG - Intergenic
1052900231 9:33787384-33787406 CCTTCTATACTGGTGAGTTTTGG + Intronic
1055766788 9:79672115-79672137 CCTCCTGTCCTGGGGAGAGAGGG + Intronic
1059938436 9:119334733-119334755 AATTCTGTACTGGTGAAATAAGG + Intronic
1062406068 9:136397295-136397317 CTATCTTTACTGGAGAGACAGGG + Intronic
1186529399 X:10279944-10279966 CTTTCTGTACTGGTTAGAATGGG + Intergenic
1187727713 X:22221036-22221058 CCATCTGTCCTGCTTAGACAGGG - Intronic
1189097233 X:38153505-38153527 CCTTCTGAACAGGTGTGATAGGG + Intronic
1190125974 X:47705868-47705890 CTTTCTGTACTGGTAAGATTGGG + Intergenic
1192420251 X:71023018-71023040 CCTCCTGTCCTTCTGAGACAGGG - Intergenic
1195419813 X:104662066-104662088 TCTTCTGTACTTGTCAAACATGG + Intronic
1196772362 X:119307794-119307816 CCTTCTGTATTAGTCAGGCAGGG - Intergenic
1198969070 X:142260077-142260099 GCTTCTGTTCTGGTAAGAGAAGG + Intergenic