ID: 1115418694

View in Genome Browser
Species Human (GRCh38)
Location 14:33167300-33167322
Sequence CATTCAAATCTCCTAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115418694 Original CRISPR CATTCAAATCTCCTAGAGAG AGG Intronic
904079957 1:27865955-27865977 GATGCAAATGTCCTAGAGATTGG - Intergenic
906320986 1:44815296-44815318 CACTCAAAACTACTAGTGAGTGG + Intronic
906820143 1:48920750-48920772 CCTCCAAGTCTCCTAGAGATAGG + Intronic
906837919 1:49103947-49103969 CATTCAAATCCCTTAGTGATTGG + Intronic
908342707 1:63198421-63198443 CATTCATTCCTCCTAGAGATGGG - Intergenic
915256618 1:154636045-154636067 GATTCAAATGTCCTGGAGACAGG + Intergenic
916576440 1:166071100-166071122 CATTCATATTTCCAAGAAAGTGG - Intronic
923984851 1:239369873-239369895 AATACAAAACTCATAGAGAGTGG - Intergenic
924897913 1:248362251-248362273 CATGAAAATCTCATAGAGTGAGG - Exonic
1063872276 10:10431056-10431078 CATCCTAATCTCCTGGAGAATGG + Intergenic
1064839126 10:19570427-19570449 AACTCAAATCTACTATAGAGGGG + Intronic
1065882431 10:30048039-30048061 CATTCTATTCACCTAGAAAGTGG + Intronic
1066191055 10:33056635-33056657 CATGCAAAGATCCAAGAGAGGGG - Intergenic
1067985068 10:51134701-51134723 CATTCAAATATCTAAGAAAGGGG - Intronic
1069302060 10:66920497-66920519 CATTCAAATGAACTAGACAGAGG - Intronic
1071008468 10:80910752-80910774 CATTCATAGCTTCTAGAGACTGG - Intergenic
1071403542 10:85303801-85303823 CTTTCAAATCTCATATAAAGTGG - Intergenic
1071493030 10:86149236-86149258 CATTGAAAACTCTTTGAGAGGGG + Intronic
1071744823 10:88405182-88405204 CATTCAAATCTCATAGATGTGGG + Intronic
1071943896 10:90618998-90619020 CATTCATATCCCTTAGAGACTGG + Intergenic
1074732144 10:116390565-116390587 CATTCAAGTTTACTATAGAGAGG - Intergenic
1076007320 10:126958060-126958082 GAGAAAAATCTCCTAGAGAGGGG + Intronic
1076616410 10:131758027-131758049 CATCACAATCTCATAGAGAGCGG + Intergenic
1079753310 11:24225600-24225622 CCTTAAAGTCTCTTAGAGAGGGG + Intergenic
1083038471 11:59663291-59663313 CATTCAAAACTCCCTGAGACAGG - Intronic
1084441304 11:69175247-69175269 CCTTCAATTCTCTCAGAGAGGGG - Intergenic
1084963423 11:72730269-72730291 CATTCATATTTCCTAGTGTGGGG - Intronic
1088562675 11:111131572-111131594 CATTGCAGACTCCTAGAGAGTGG - Intergenic
1089321886 11:117631963-117631985 CATTCTTATCTGCAAGAGAGAGG - Intronic
1090875498 11:130785260-130785282 CATGGAAATCTCCAGGAGAGAGG - Intergenic
1091463361 12:662781-662803 CAGTCTAATCTCCTAGGAAGAGG - Intronic
1091905089 12:4179258-4179280 TATTCAAAACAACTAGAGAGTGG + Intergenic
1092490278 12:8938740-8938762 CATTCAAATAGCTTAGAGACAGG - Intronic
1093285977 12:17263887-17263909 TATTCAAATCTACTAGAAAGTGG - Intergenic
1094113473 12:26885017-26885039 CATACAAATCACCAAGGGAGCGG + Intergenic
1094720615 12:33059330-33059352 CATTCACAGCTCTCAGAGAGAGG - Intergenic
1100727576 12:97425199-97425221 TAATCAAATCTCCAAGAGAAAGG - Intergenic
1100745707 12:97643428-97643450 CATCCTAATCACCTAGTGAGGGG + Intergenic
1101272717 12:103164690-103164712 GATTCAAAGCTCTTGGAGAGCGG + Exonic
1101585288 12:106080392-106080414 CATTCCATTCTCCCAGAGAGTGG + Intronic
1103940712 12:124499868-124499890 CCTGCAAATGTCCAAGAGAGGGG + Intronic
1104212580 12:126703806-126703828 CAATCAAATCTTCCAGTGAGAGG + Intergenic
1104219982 12:126773341-126773363 CATTCTAATCTCCTGGGGAGAGG + Intergenic
1108736732 13:53291905-53291927 AATTGTAAGCTCCTAGAGAGTGG + Intergenic
1109694794 13:65939924-65939946 CTTTCAAATCCTCTAGAGATGGG - Intergenic
1109887750 13:68564480-68564502 TATTTAAACCTACTAGAGAGAGG - Intergenic
1110456185 13:75692794-75692816 AAGTTAAATCTCCTAGAGAAAGG - Intronic
1110566912 13:76966324-76966346 CATTCTTATCAGCTAGAGAGTGG + Intergenic
1115418694 14:33167300-33167322 CATTCAAATCTCCTAGAGAGAGG + Intronic
1115715815 14:36102065-36102087 CCTGCAAATCTGCTAGAGTGTGG + Intergenic
1116513667 14:45780013-45780035 CATTGACATCTCTGAGAGAGGGG - Intergenic
1117666104 14:58057855-58057877 CTTTCAAATCAACAAGAGAGAGG + Intronic
1119536235 14:75404717-75404739 CATTCAAATCTGCTATGGAATGG - Intergenic
1125186703 15:36939222-36939244 AATTCAAATAAGCTAGAGAGTGG - Intronic
1127492728 15:59480245-59480267 ATTTCAAATCACCTAGAGAAAGG - Intronic
1130240049 15:82179658-82179680 CATTGAAATCTCCTTCACAGTGG + Intronic
1130973424 15:88753832-88753854 CATTCAAATATCAATGAGAGGGG - Intergenic
1132539200 16:500369-500391 TATTTAAATCCCCTAGAAAGAGG - Intronic
1137708782 16:50552379-50552401 CATACAAAACTCCCAGAGAGGGG + Intronic
1148822318 17:50366783-50366805 CTTTCCAATCTCCTGGAGAAAGG - Intergenic
1151474094 17:74335740-74335762 CATTGAAACCTCCCAGAGACAGG + Intronic
1153752563 18:8248234-8248256 AACTCCAATCTCCTACAGAGTGG - Intronic
1156383571 18:36585900-36585922 CATCCAACTCTCCTAGAAAAGGG - Intronic
1157782760 18:50454685-50454707 CATTCAAATCCCTTAAAGACAGG + Intergenic
925125682 2:1454012-1454034 GATTGAAATCTCTTAGTGAGTGG + Intronic
925801757 2:7608710-7608732 TTTTCAAATCTCCTACAGTGAGG - Intergenic
926051651 2:9748954-9748976 CATTTAATTCTCGTAGAGCGTGG + Intergenic
926888044 2:17615749-17615771 CATTCAAGTCTGCCAGAGATAGG + Intronic
927779104 2:25925144-25925166 CATTTCATTCTCCTAGTGAGAGG - Intergenic
927879003 2:26677305-26677327 CCTTCAGATCTTCTAGACAGCGG + Intergenic
930669691 2:54135700-54135722 CATTAAAATCACCCAAAGAGAGG - Intronic
930862611 2:56090590-56090612 CATTTAAATGTGCTAGAGAAAGG + Intergenic
935154108 2:100466865-100466887 CATTGAAATATCCGAAAGAGGGG + Intergenic
937792580 2:125978165-125978187 CATAAAAATCACATAGAGAGTGG + Intergenic
937823298 2:126335660-126335682 CAGTCACAGCCCCTAGAGAGGGG + Intergenic
940065203 2:149619898-149619920 AACTGAAATCTCCTTGAGAGTGG - Intergenic
940149458 2:150583559-150583581 CACTCAGATCTACTTGAGAGGGG + Intergenic
940324865 2:152414601-152414623 CATTCAAATCTCCACTTGAGGGG - Intronic
942505832 2:176640604-176640626 TATTCAAAACTCCAAGAGATTGG + Intergenic
944277032 2:197850861-197850883 CATGAAACTCTCCTGGAGAGAGG - Intronic
947451288 2:230211384-230211406 CATTCGGATCTTCTAGAGAGGGG - Intronic
947836456 2:233179464-233179486 CATTCAAAACTGCTCGACAGTGG + Intronic
1170244866 20:14209435-14209457 CATTGACATTTCTTAGAGAGAGG - Intronic
1171170468 20:23011244-23011266 AATCCAATTGTCCTAGAGAGTGG + Intergenic
1173401451 20:42729732-42729754 CATTCAGATCTCTTGGGGAGTGG + Intronic
1177393571 21:20506806-20506828 CAGTCACACCTCCTAGAGAGTGG - Intergenic
1180246218 21:46549593-46549615 CATTCTAATCTCCTCGAGGATGG - Intronic
1181993829 22:26859216-26859238 CATTCAAGCCTCCTGGAGACAGG - Intergenic
956732067 3:72205397-72205419 AACTTAAATCTCCTAGAGAAGGG + Intergenic
958823872 3:99007177-99007199 CAGTCACATCCCCTAGAGAGGGG - Intergenic
959219306 3:103495874-103495896 TACTCAATTCTCTTAGAGAGAGG + Intergenic
961524917 3:127490652-127490674 CATTCACAGGTCCTGGAGAGGGG - Intergenic
962353852 3:134677311-134677333 CACTCAAATCTCCCAAAGAGTGG + Intronic
962398406 3:135037247-135037269 GTTTCAAATCTCCAAGAGACAGG + Intronic
962670521 3:137701448-137701470 TCTTCAAAGCTTCTAGAGAGAGG - Intergenic
964774443 3:160259912-160259934 CATTCAACTCCCCTAAACAGAGG - Intronic
965939995 3:174168440-174168462 CAGTCACATCTCCTAGGGAGGGG - Intronic
966217168 3:177516070-177516092 CATTGAAATGTGCTATAGAGGGG + Intergenic
970147347 4:13050740-13050762 CAGTCAAACCTGGTAGAGAGAGG + Intergenic
971226461 4:24757632-24757654 CAGTAACAACTCCTAGAGAGAGG - Intergenic
972824220 4:42737468-42737490 AAGTCACATCTCCTAGGGAGTGG + Intergenic
976848226 4:89514480-89514502 TATTCAGATCTCCTACTGAGAGG + Intergenic
977376544 4:96212260-96212282 CCTTCAAATCACCTAGAAAATGG + Intergenic
980119253 4:128710697-128710719 GATTCTAATCTCCTAGAAAATGG + Intergenic
983389395 4:167110019-167110041 CAAGCAAATACCCTAGAGAGAGG - Intronic
987245599 5:16045160-16045182 CATTCAACTCCTCTACAGAGAGG - Intergenic
987855605 5:23415921-23415943 GAATGAAATCACCTAGAGAGAGG - Intergenic
989829313 5:45894097-45894119 CATTCATATCTCCCAGAGGCAGG + Intergenic
993045039 5:82857170-82857192 AAATCAACTCTCCTAGACAGGGG - Intergenic
1001625655 5:173130791-173130813 CATTTAAATCTGCTAGGCAGAGG - Intronic
1001926804 5:175643164-175643186 CATTCAGGTCTTCTTGAGAGAGG - Intergenic
1002876868 6:1218458-1218480 CATTTTAATCTCCCAGAGGGCGG + Intergenic
1006869082 6:37234181-37234203 CATTCAAATCTGGGAGACAGAGG - Intronic
1008724680 6:54402264-54402286 GATTGAAATCTTCTAGAGAGAGG + Intergenic
1011670619 6:89679866-89679888 CATTTGCATCTCCTGGAGAGGGG - Intronic
1012058030 6:94440513-94440535 CATAGATGTCTCCTAGAGAGAGG + Intergenic
1012880988 6:104789609-104789631 CATTTAAATCACCTATAGAGAGG + Intronic
1013225143 6:108115355-108115377 CATTCAAAGCTCCGAGGGGGCGG + Intronic
1014303012 6:119707084-119707106 CCCTGACATCTCCTAGAGAGAGG - Intergenic
1016379487 6:143460500-143460522 CATTAAAATGTCCTAGGCAGTGG - Intronic
1022070673 7:26910569-26910591 CCTTCAAAGCTCCTAGTGAGCGG + Intronic
1024137566 7:46426226-46426248 CATTCAAACCTCCTTGGCAGAGG - Intergenic
1024242478 7:47446309-47446331 TTTTCAAAACACCTAGAGAGTGG - Intronic
1028158602 7:87460445-87460467 CACTGAGATCTACTAGAGAGGGG - Intronic
1028625717 7:92875029-92875051 CTTTCAAATCTCCCAAAGAATGG + Intergenic
1028868507 7:95739234-95739256 CATTCATATCCCCCAGGGAGAGG + Intergenic
1030827180 7:114172402-114172424 CATTAAAATATCATAGAGAATGG - Intronic
1030888378 7:114966763-114966785 CATCAAAATCTTCCAGAGAGTGG - Intronic
1038032072 8:23651216-23651238 CATTCAAATGTACTAGATGGGGG - Intergenic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1040917274 8:52575423-52575445 CAGTAAAATCTCCTCTAGAGTGG - Intergenic
1042028723 8:64450711-64450733 CATTCAAAGCTTCTAGAGATAGG + Intergenic
1042583235 8:70305328-70305350 AATTCTCATCTCCTACAGAGAGG + Intronic
1045333244 8:101175536-101175558 CATTCAAACCTCATCGATAGTGG - Intergenic
1046396252 8:113644122-113644144 GATTAAAATGTCCTTGAGAGAGG - Intergenic
1047326296 8:123839517-123839539 AATTCAATTCTCCTAGGGTGGGG - Intergenic
1048717478 8:137284949-137284971 CATTGCACTCTCCTTGAGAGGGG - Intergenic
1050004166 9:1111099-1111121 CATTCAAATTTTCTTGAGAAAGG + Intergenic
1050117034 9:2273969-2273991 CATTCAAATTTCCTAGTAGGAGG - Intergenic
1051126119 9:13807790-13807812 TATTCACAGATCCTAGAGAGAGG + Intergenic
1051739560 9:20238388-20238410 CATTTAAATTTCCTTTAGAGTGG + Intergenic
1052304760 9:26994776-26994798 AATAAAAATCTCCCAGAGAGAGG + Exonic
1052660256 9:31419855-31419877 CATTTAAATGTTCTAGATAGTGG - Intergenic
1053554497 9:39121662-39121684 GATTGAAAACTCCTAGAGTGGGG + Intronic
1053818594 9:41941804-41941826 GATTGAAAACTCCTAGAGTGGGG + Intronic
1054108859 9:61085462-61085484 GATTGAAAACTCCTAGAGTGGGG + Intergenic
1054611998 9:67245663-67245685 GATTGAAAACTCCTAGAGTGGGG - Intergenic
1055220493 9:73924829-73924851 GATTCATATTTCCTAGTGAGAGG + Intergenic
1057147218 9:92766076-92766098 CATTCGGTTCTCCTAGAGAGTGG + Intergenic
1058269594 9:102954084-102954106 CATTCAAACATTTTAGAGAGAGG - Intergenic
1060040682 9:120297806-120297828 CATTCAGAATTCCCAGAGAGTGG - Intergenic
1060535910 9:124387943-124387965 CATTCAAGTTTCCTAGATACTGG + Intronic
1198396674 X:136226007-136226029 TATGCAAATTTCCTAGAAAGGGG - Exonic
1199322486 X:146456381-146456403 CAGTCACATCTCCTAGGGAGGGG + Intergenic
1199529773 X:148833237-148833259 CATGCGAATCACCTTGAGAGGGG - Intronic
1201649906 Y:16273957-16273979 CATTGAAATCCCCTAGATATAGG - Intergenic