ID: 1115426505

View in Genome Browser
Species Human (GRCh38)
Location 14:33266583-33266605
Sequence CTATATTCCTTATGTACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115426504_1115426505 -2 Left 1115426504 14:33266562-33266584 CCTACTGTATCTGATACTTTACT 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1115426505 14:33266583-33266605 CTATATTCCTTATGTACACTTGG 0: 1
1: 0
2: 0
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115426505 Original CRISPR CTATATTCCTTATGTACACT TGG Intronic
910127482 1:83860415-83860437 CTTTATTCCTCATGTAAAATAGG + Intergenic
920395834 1:205645287-205645309 CTGTGGTCCTTATGTTCACTGGG - Intergenic
921232474 1:213087344-213087366 CTATATTTCTTATCAACATTGGG + Intronic
922357560 1:224790807-224790829 TTTTTTTCCTTATGAACACTAGG - Intergenic
923267069 1:232324955-232324977 CTATATTCCTCATGTCCTCTTGG + Intergenic
923634061 1:235677276-235677298 ATGTATGCCTTATGTACAATAGG - Intronic
1065636624 10:27741981-27742003 CTTTATTCCCTATGTCCAGTCGG - Intronic
1066043295 10:31574639-31574661 CTTTCTTACTTATGAACACTAGG - Intergenic
1071771935 10:88738876-88738898 CAATATTACTTATGTACCCCTGG - Intronic
1075628146 10:123979227-123979249 CTATTTTCCCTATATAAACTTGG - Intergenic
1075894170 10:125980107-125980129 CTCTCTTCCTTATGGAAACTGGG + Intronic
1081005799 11:37736811-37736833 CTCTATTCCTTATTTATACCAGG - Intergenic
1083814136 11:65122558-65122580 CTCGATTCTATATGTACACTCGG - Intronic
1086252737 11:84836842-84836864 GTATATGCTTTATGGACACTGGG - Intronic
1088419384 11:109625679-109625701 CTGTATTCTTTATATATACTTGG - Intergenic
1089001949 11:115059534-115059556 CTATCTTCATTATTTACACATGG - Intergenic
1089596229 11:119582486-119582508 CTCTATACCTCATGTACACATGG + Intergenic
1089807096 11:121100305-121100327 TTATATTTCTTTTGTACAGTTGG + Intergenic
1093587757 12:20861485-20861507 CAATAATCCATTTGTACACTAGG - Intronic
1094133174 12:27096993-27097015 CTATCTTCCTTTTCTACTCTGGG + Intergenic
1094182996 12:27612204-27612226 CTATCTTCCTTTTCTACTCTGGG + Intronic
1096912892 12:55001790-55001812 CTAAATTCAGTGTGTACACTGGG - Intergenic
1099355407 12:81628887-81628909 CTATAGGCCTTATGTGCAATTGG - Intronic
1100624164 12:96313110-96313132 CTATATTACATATCTACATTGGG + Intronic
1101164409 12:102013535-102013557 CTCTGTACCTCATGTACACTTGG - Intronic
1107783246 13:43927406-43927428 CTATCTTACTTAAGTAAACTGGG + Intergenic
1112624385 13:101087142-101087164 CTATATTACTAATATAGACTTGG + Intronic
1115426505 14:33266583-33266605 CTATATTCCTTATGTACACTTGG + Intronic
1118913862 14:70084689-70084711 CTATATGCCTAATGGAGACTTGG + Intronic
1121323456 14:93006314-93006336 CTATATTCATTCTGTTCACCAGG - Intronic
1123164917 14:106317485-106317507 CAATATCCATTATGTCCACTTGG + Intergenic
1129377388 15:75142554-75142576 TTATCTTCCTTATGTACCCTGGG - Intergenic
1133837283 16:9378345-9378367 CTATCTTCCCCATGTAAACTAGG + Intergenic
1148993837 17:51690291-51690313 CTATAGTCATCATGTACAGTAGG + Intronic
1149729457 17:58930786-58930808 CTCTATTCCTTTTAAACACTTGG - Intronic
1155181036 18:23346946-23346968 CAATATTCCTCATGAACACAGGG - Intronic
1158039384 18:53073865-53073887 GTATATTCCTTTTGTCCATTTGG - Intronic
1158758361 18:60353622-60353644 CTAGAATCCTTCTGTAGACTCGG - Intergenic
1159371246 18:67530146-67530168 ATATTTTCCTTGTGTCCACTAGG - Intergenic
1162985622 19:14267516-14267538 CCACATTCCTGATGTACACCTGG + Intergenic
925500662 2:4500730-4500752 CCATATTACTTATAGACACTAGG + Intergenic
927312722 2:21648896-21648918 CTATATTCCAAATGTGCACCTGG + Intergenic
928843702 2:35643112-35643134 CTATCATTCTTGTGTACACTGGG - Intergenic
933833860 2:86230754-86230776 CTAGATTTCTTATCTACACAAGG - Intronic
936653597 2:114457975-114457997 CAATATTCCTTATGTGCTGTCGG + Intronic
939090769 2:137777585-137777607 CTGTATCACTTATGGACACTTGG - Intergenic
940483122 2:154261165-154261187 CTGCATTCCTTCTGTACCCTTGG - Intronic
940941203 2:159563307-159563329 ATATATTCATTATGTACCTTAGG + Intronic
942504960 2:176632170-176632192 TTCTAATACTTATGTACACTTGG + Intergenic
943879768 2:193127123-193127145 GTATTTTACTTATGTAAACTAGG + Intergenic
947297299 2:228645579-228645601 TTATATTGCATATGTGCACTTGG + Intergenic
1169938072 20:10906285-10906307 CTATATTCCTAATGCACTTTGGG - Intergenic
1173903465 20:46607982-46608004 CTTTATTCATTTTGTACACTGGG - Intronic
1174109499 20:48188549-48188571 CTATATTCTTGATGTATAATTGG + Intergenic
1177199475 21:17937659-17937681 CTAGATTTCTTTTTTACACTTGG + Intronic
1177838468 21:26211376-26211398 ATATATACCTCATGTATACTGGG - Intergenic
1178516378 21:33250958-33250980 CTAGATTCCTTACGGACACCTGG - Intronic
1178889945 21:36512897-36512919 CTATATTTCTTATGTAAAAAAGG + Intronic
1179773906 21:43646979-43647001 CTATATTCCATATAGACATTTGG - Intronic
952910119 3:38177493-38177515 CAAAATTGTTTATGTACACTAGG + Intronic
953175009 3:40542908-40542930 ATATATTTCTTATGAACTCTGGG - Intronic
957646056 3:82929196-82929218 CTATATTTCTAATCTATACTTGG - Intergenic
957916540 3:86694482-86694504 GTATGTTCCTTATGAACAGTAGG - Intergenic
964503938 3:157377975-157377997 CTATTTTCCCTATGGACACAAGG - Intronic
965398028 3:168184120-168184142 ATATAATCCTTAGGGACACTGGG - Intergenic
965794022 3:172419571-172419593 CTAAACTCCTTAAGTACACATGG - Intergenic
966557087 3:181274815-181274837 CTATATACCTTATTAAAACTTGG - Intergenic
966667696 3:182490690-182490712 TTATATTCCTTATCTACAGTGGG + Intergenic
973042566 4:45489675-45489697 CCATATTCCTCATGTATAGTAGG - Intergenic
974134422 4:57796916-57796938 TTAAGTGCCTTATGTACACTAGG + Intergenic
974624593 4:64406842-64406864 CAACATTTCTTTTGTACACTGGG + Intronic
977708012 4:100093046-100093068 CTTTATTGCTTATGTTCACTGGG + Intergenic
980875977 4:138662560-138662582 TTATAATCCTTTTGTCCACTCGG + Intergenic
981098512 4:140806048-140806070 CTTTATCCCTTATGTCCACTAGG - Intergenic
982490116 4:156019756-156019778 ATATATTCCTCATGTATACATGG - Intergenic
982892499 4:160873168-160873190 CTATATTCTTCATTTACCCTTGG - Intergenic
983249906 4:165331612-165331634 CAATATTCCTTCTGTAGAATGGG + Intronic
984187486 4:176563831-176563853 CAAAATTCCATATGCACACTGGG - Intergenic
984677978 4:182571775-182571797 CTATGTTAATTATATACACTTGG - Intronic
985990252 5:3551636-3551658 TTAACTTCCTTATGGACACTGGG - Intergenic
987154500 5:15075572-15075594 CTGTATTCCTAATGAAAACTGGG - Intergenic
988469231 5:31522660-31522682 AGATATTCCTTAGGTACATTAGG + Intronic
990154867 5:52864606-52864628 TTATATTCCTTAAGAAGACTTGG + Intronic
990417084 5:55597020-55597042 CTGTTTTCCTTATGTACACCAGG + Intergenic
991214566 5:64147760-64147782 CTATATTGCTTGTGTAATCTTGG + Intergenic
992098701 5:73385054-73385076 CTTTATTCTATCTGTACACTTGG - Intergenic
994114582 5:96047966-96047988 CTATATTCCCTATAATCACTTGG - Intergenic
999848333 5:155509777-155509799 CAATATTGCTTATGAGCACTTGG - Intergenic
1000530137 5:162409386-162409408 CTCTCTTCCTTATGTAAAATGGG + Intergenic
1001349524 5:170945527-170945549 CTCTAGTACTTATTTACACTAGG - Intronic
1004655828 6:17659427-17659449 ATAAATTCCTTATTTACACAAGG + Intronic
1006263695 6:32897504-32897526 ATTTACTCCTTATGTACACTTGG - Intergenic
1009831611 6:68944048-68944070 TAATATTTCTTGTGTACACTAGG - Intronic
1012404622 6:98880881-98880903 CTATATTCCCTATGACCTCTCGG + Intronic
1013547900 6:111177644-111177666 CTTTGTGCCTTATGTTCACTTGG + Exonic
1017209338 6:151837569-151837591 CTTCATTCCTTAGCTACACTTGG + Intronic
1019007508 6:168812661-168812683 CTATATCCCTAATATACAATAGG + Intergenic
1020924881 7:14312832-14312854 CTAAATTCCTAATTTTCACTTGG - Intronic
1023461457 7:40402094-40402116 CTTTACCCCTTATATACACTTGG + Intronic
1026190721 7:68123886-68123908 CAATATTCCTTATGTATAATTGG - Intergenic
1029809331 7:103031980-103032002 TCTTATTCCTCATGTACACTGGG + Intronic
1030847638 7:114441092-114441114 TTTTATTACTTATGTACACATGG - Intronic
1031643899 7:124200118-124200140 CAATATTCATTATGTACAACAGG - Intergenic
1032099972 7:128967204-128967226 CTTTATTTCTTATGTGCCCTTGG - Intronic
1033458481 7:141523923-141523945 CTCTACTCCTGATGTACATTTGG + Intergenic
1037577377 8:20220453-20220475 CTTTATTCCTTTTGCACTCTCGG + Exonic
1041956621 8:63563146-63563168 CTATATTCCATATGTTAAATGGG - Intergenic
1043415974 8:80049835-80049857 TTATATTCTTTATGTACACAAGG - Intronic
1044860064 8:96514571-96514593 CTAGAGTCCTTCTGTACATTAGG - Intronic
1046350283 8:113000648-113000670 CAATCTACCTTATGGACACTTGG + Intronic
1046746896 8:117885812-117885834 CTATAATCCACATGTACACCTGG + Intronic
1047867817 8:129047654-129047676 CTACACTACTTATGTACAGTTGG + Intergenic
1050560580 9:6830955-6830977 GTATATTCTTTATTTAAACTGGG + Intronic
1050847572 9:10241942-10241964 CTATATTTCTTATTTACAAATGG + Intronic
1051659365 9:19410883-19410905 CTATATTCTTTATTTACAAAAGG - Intronic
1186035561 X:5419323-5419345 CTATATTCCTTATGTTGACATGG + Intergenic
1190641812 X:52487529-52487551 CTAAATTCCGTATGTCCTCTGGG - Intergenic
1190645860 X:52525337-52525359 CTAAATTCCGTATGTCCTCTGGG + Intergenic
1192807718 X:74524788-74524810 CTTTGTTCCCTATGTACACCTGG + Exonic
1193217952 X:78886749-78886771 CTATATACTTTATACACACTAGG - Intergenic
1194408290 X:93525450-93525472 CTATATTCATTATCTAGCCTTGG - Intergenic
1194796720 X:98220406-98220428 CTATATTTATTATGTGGACTGGG - Intergenic
1197415647 X:126168610-126168632 CTAAATACTTTATGTACATTTGG + Intergenic
1197669404 X:129259614-129259636 CTATTTGCCTTATGTATTCTGGG + Intergenic
1199263480 X:145803072-145803094 CTATATTACTCATGGTCACTGGG - Intergenic
1199514459 X:148660510-148660532 GTATACTCCCTGTGTACACTAGG + Intronic
1202058336 Y:20859441-20859463 CTAGATTCAGTCTGTACACTGGG - Intergenic