ID: 1115439485

View in Genome Browser
Species Human (GRCh38)
Location 14:33415788-33415810
Sequence AAGGGTATACACTGTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115439485 Original CRISPR AAGGGTATACACTGTCAAGA AGG (reversed) Intronic
905176397 1:36138381-36138403 ATGTGTATTCACTTTCAAGAAGG - Intronic
908504456 1:64782352-64782374 TAGGGTAAAAACTGTGAAGAAGG - Intronic
910012436 1:82481693-82481715 AAGGGAATAGTCTGTAAAGAAGG + Intergenic
912481121 1:109983015-109983037 CAGGGCATACCCTTTCAAGAAGG - Intergenic
913247790 1:116885484-116885506 AAGGGAATACTCTGGAAAGAGGG - Intergenic
918417424 1:184325810-184325832 AAGGGTACATACTGTCAACGTGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920927267 1:210353543-210353565 AAAGCTATAAAATGTCAAGATGG - Intronic
921306482 1:213802098-213802120 AATGGTGTAAACTGTGAAGAAGG + Intergenic
923986321 1:239386739-239386761 AAGGGAATACACGATAAAGAAGG + Intronic
1066331674 10:34430104-34430126 AATGGTAAACACTTTCAATAAGG - Intronic
1071962949 10:90824275-90824297 AAGGGAAAACACTGTCTTGAAGG + Intronic
1072389783 10:94971326-94971348 ATGGGTTTACAATGACAAGATGG - Intronic
1074047907 10:109855780-109855802 AAGGGTACATACTATCAACATGG - Intergenic
1074061394 10:109969373-109969395 AAGGGATTATACTGGCAAGAGGG + Intergenic
1074092866 10:110278936-110278958 AATGGTAATCTCTGTCAAGATGG - Intronic
1080031306 11:27664466-27664488 AAAGGAATGCATTGTCAAGAAGG + Intronic
1083009286 11:59380498-59380520 AAAGGTATACATTGGTAAGATGG - Intergenic
1084918463 11:72449593-72449615 ACGGGGTTTCACTGTCAAGATGG + Intergenic
1087323488 11:96692678-96692700 AAGGGTACATACTATCAACATGG + Intergenic
1087377025 11:97356157-97356179 AAGGGTGGATACTGTTAAGAAGG + Intergenic
1087561631 11:99797111-99797133 AATGTGATACAGTGTCAAGATGG - Intronic
1093884787 12:24447254-24447276 AAGGGCACACGCTGTCAACATGG - Intergenic
1094192091 12:27708290-27708312 AAGGAAATACACTGGGAAGAGGG - Intergenic
1095530031 12:43176054-43176076 TAGGGTATAGACTGTCTAGGAGG - Intergenic
1097692837 12:62749368-62749390 ATTGATATACACTGTCAAAAAGG - Intronic
1099103834 12:78477052-78477074 AAGTGGTTACACTGGCAAGAAGG - Intergenic
1101111388 12:101489931-101489953 AAGGGTATACAATTTCAAACAGG + Intergenic
1102137482 12:110587268-110587290 AAGGTTATAGAGTGTCAGGATGG + Intergenic
1106701458 13:32233541-32233563 AAGTGTAGATACTGTGAAGAAGG - Intronic
1108694427 13:52890309-52890331 ATGGGTATACAGTTTCAATATGG - Intergenic
1109076342 13:57840909-57840931 CAGGGAATACACAGTAAAGAAGG - Intergenic
1111958892 13:94787794-94787816 AAGCCTATAAACTGTCAACAGGG - Intergenic
1112686595 13:101835691-101835713 AAGTGGAGACACTGGCAAGATGG + Intronic
1112847362 13:103660502-103660524 AAGGGTATTCACTGGGAAAAAGG - Intergenic
1112974980 13:105306138-105306160 AAGAAAATACAGTGTCAAGAAGG + Intergenic
1114222718 14:20711360-20711382 ACGGGCATACACTACCAAGAAGG + Intergenic
1114801937 14:25784862-25784884 TATGGTATACACAGCCAAGATGG - Intergenic
1115439485 14:33415788-33415810 AAGGGTATACACTGTCAAGAAGG - Intronic
1117533448 14:56681352-56681374 AAGACTCTTCACTGTCAAGATGG - Intronic
1118563149 14:67108832-67108854 AAGCTTAAAAACTGTCAAGATGG - Intronic
1119627953 14:76198121-76198143 AAGGTGCTACACTTTCAAGATGG - Intronic
1123835075 15:24181483-24181505 AAGAGTAAAAACTGTCAACAAGG + Intergenic
1127827379 15:62716718-62716740 AAGGATATACACATTCAAGAAGG + Intronic
1128152360 15:65371308-65371330 GAGGGTACAGACTCTCAAGAGGG + Intronic
1128905489 15:71464262-71464284 AAGGGTACACTCTGCCATGAAGG - Intronic
1131621969 15:94078096-94078118 AAGGGGACACACTGCCAGGAAGG + Intergenic
1134474953 16:14565231-14565253 AAGGGTAACCACTGGCTAGATGG + Intronic
1142484153 17:235974-235996 AAGGCTCTACACTAACAAGACGG + Intronic
1146148937 17:30449894-30449916 AAGGGTATATACTACAAAGATGG - Intronic
1148848856 17:50544595-50544617 ATGGGAAGACACTGTCAAGATGG - Intronic
1150661462 17:67083869-67083891 AAGTGTATTCAGTGTCAAAACGG + Intronic
1153364838 18:4243845-4243867 AAAGGTATACAATGTCAAAATGG + Intronic
1154342199 18:13513046-13513068 AAGGGTCTAAACTGCCCAGAGGG + Intronic
1156097983 18:33559691-33559713 AAGGGTACATACTATCAATATGG - Intergenic
1157419165 18:47531105-47531127 AAGGATAGACACTGGCAAGTGGG - Intergenic
1160463811 18:79059151-79059173 AAGGGAGTAGACTGCCAAGAGGG + Intergenic
1160574029 18:79838793-79838815 CAAGCTATACAGTGTCAAGAGGG + Intergenic
1162616184 19:11802458-11802480 AAGGGAACACACTATCAACAAGG - Intronic
1167382662 19:49147892-49147914 AAGAGTATATGCTGTCATGAAGG + Intronic
925799794 2:7586973-7586995 AAGGGTATATACTCTCAACTTGG - Intergenic
926647905 2:15309867-15309889 AAGAGTATGCATTGTCAATACGG + Intronic
927498107 2:23564116-23564138 AAGGACAGACACTTTCAAGACGG - Intronic
930298392 2:49583952-49583974 AAGGGCATACAGTCTCCAGAGGG - Intergenic
936681560 2:114779137-114779159 AGGGGTATACACTGATGAGAAGG - Intronic
936769724 2:115897163-115897185 AAGGGTACATACTATCAATATGG - Intergenic
936902934 2:117504371-117504393 GAGGGTAGACAAGGTCAAGATGG - Intergenic
937111098 2:119367547-119367569 AAGGGTCTACACTGGAGAGAAGG - Exonic
937961239 2:127461114-127461136 AAAAGTATATATTGTCAAGATGG + Intronic
943427920 2:187759397-187759419 AAGGGAATCCACTGTCTTGAAGG - Intergenic
944813841 2:203355159-203355181 GAGGATATGCACTGTCAAAACGG - Intronic
944981518 2:205126249-205126271 AAGGGTATACATTTTTAATAAGG - Intronic
1169127954 20:3144075-3144097 AAGGCTTAATACTGTCAAGATGG + Intronic
1170086982 20:12544701-12544723 AAGGGAATCCACTGTCTTGATGG - Intergenic
1171419744 20:25010040-25010062 AAGAGTTCACACTGTGAAGAGGG + Intronic
1175000383 20:55621757-55621779 AGGGGGTTACACTGGCAAGAAGG + Intergenic
1178440296 21:32593074-32593096 AAGGGTATCCTCTGGGAAGAAGG - Intronic
1179363554 21:40734735-40734757 AAGGGTATTAACTGAAAAGAAGG - Intronic
1179840064 21:44066495-44066517 AAGGAAATACTCTGTCAAGGAGG - Intronic
951928302 3:27934865-27934887 AACAGTAAACACTGTAAAGAAGG - Intergenic
953267685 3:41408503-41408525 AAGATTAAACACTGTTAAGATGG + Intronic
960748176 3:120913247-120913269 TAGGGTATACACTATCTAGCTGG + Intronic
962449150 3:135497456-135497478 CAGGGTATTCACTGACCAGATGG + Intergenic
970511986 4:16790060-16790082 AAGGGTATACAGGGACAACATGG - Intronic
971933186 4:33112738-33112760 ATGGGTAAAGAATGTCAAGATGG - Intergenic
972673322 4:41234984-41235006 AAGGGGCTAATCTGTCAAGATGG - Intergenic
972990392 4:44816531-44816553 AAGGGTACATACTATCAACATGG + Intergenic
974362606 4:60901674-60901696 TAGGGTAGACACAGTCCAGAGGG - Intergenic
974366925 4:60962317-60962339 AAGGGGAAAGAATGTCAAGATGG - Intergenic
976405228 4:84655222-84655244 AAAGGTATACACTATGAAAAAGG - Intergenic
978205636 4:106077361-106077383 AATGGTATAGAGTGTCAAGGCGG + Intronic
980870139 4:138601857-138601879 AATGGTATATACTTTCCAGAAGG - Intergenic
982732477 4:158971163-158971185 GAGGCTATACACACTCAAGATGG + Intronic
983474613 4:168198376-168198398 AAAGGCACACACTGTCAAGCTGG + Intergenic
989164995 5:38425071-38425093 AAAGGTCGACACTGTGAAGATGG + Exonic
989997729 5:50855609-50855631 AAGGGTTTCCACTCTCATGAAGG - Intergenic
990639828 5:57770197-57770219 AAGGGTACATACTGTCAATGTGG + Intergenic
993475608 5:88360555-88360577 AAGGGTACATACTGTCAACATGG + Intergenic
994721987 5:103391054-103391076 AAGGGTATCCAGTTTCATGATGG + Intergenic
996144070 5:119951871-119951893 AAAGCTATACACTGGCCAGATGG - Intergenic
997835651 5:137191002-137191024 AAGGGTAGACACTGACAGGAAGG - Intronic
1000464184 5:161554722-161554744 AGGGAAATATACTGTCAAGATGG - Intronic
1006797843 6:36742476-36742498 AAGGGTACAAACTGGCAAGTGGG + Exonic
1009396919 6:63210937-63210959 GAGGGTATACAGTGTGGAGATGG - Intergenic
1009842577 6:69095052-69095074 AAAGGAATACACACTCAAGAGGG - Intronic
1012104783 6:95143173-95143195 AAAGGCATGCACTGTCAAGATGG + Intergenic
1017552149 6:155520508-155520530 AAGGAGATACACAGGCAAGAAGG - Intergenic
1022114613 7:27251384-27251406 AAAGGTATACGCTGTTAACAGGG + Intergenic
1030485763 7:110165204-110165226 AAAGGTTTACTCTGCCAAGATGG + Intergenic
1031242884 7:119268782-119268804 AAAGGTATAGACTGGCAAGTTGG - Intergenic
1031504217 7:122560813-122560835 AAGGTTCTACACTCTCAAGAAGG - Intronic
1031924140 7:127621903-127621925 AAGGGTATATACTGTCAACATGG + Intergenic
1034367276 7:150561922-150561944 AAGGTTAAACACTATCTAGAAGG - Intergenic
1036457067 8:8919014-8919036 AAGGGTACATACTATCAAGATGG + Intergenic
1037258732 8:16983609-16983631 AAGGGCACAAACTTTCAAGATGG - Intergenic
1041823242 8:62063276-62063298 AAGGGAATACACTGCCTTGAAGG + Intergenic
1043724248 8:83589625-83589647 AAGGGTACACATTATCAACATGG - Intergenic
1045066797 8:98454696-98454718 AAGAAAAAACACTGTCAAGATGG + Exonic
1047275685 8:123403042-123403064 AAGGGTATGCATGGGCAAGATGG + Intronic
1050621529 9:7457256-7457278 AAGGGAATAAAATGTCAGGATGG + Intergenic
1051117615 9:13714973-13714995 AAGGGTTCACACTGTCAATATGG - Intergenic
1051329658 9:16010860-16010882 AAGAGTATACAATGAGAAGAGGG + Intronic
1051860065 9:21614625-21614647 AAGGGTATATGCTGTCGATATGG - Intergenic
1052606974 9:30716645-30716667 AAAGGTATATGCTCTCAAGAAGG - Intergenic
1055794458 9:79960019-79960041 AAGTGTAAACACTGTGAACAAGG + Intergenic
1055803827 9:80070487-80070509 AAGGGTAGACAGTGTAAAAATGG + Intergenic
1058311607 9:103510550-103510572 AAGGGTTTTCCCTGTCAAGATGG - Intergenic
1058527715 9:105876949-105876971 AAGTGTATACAGTATCAACAGGG - Intergenic
1058911077 9:109520598-109520620 AAAAGGAAACACTGTCAAGAAGG - Intergenic
1059233116 9:112739899-112739921 AAGGGCACATACTGTCAACATGG - Intergenic
1187529579 X:20084299-20084321 AGGTGTATACACTGTGAAGAAGG - Intronic
1188373720 X:29401788-29401810 AAGGATATACATTTTCAATAAGG - Intronic
1189714909 X:43855329-43855351 AAGTCTATACACTGTTAGGATGG - Intronic
1194422325 X:93691753-93691775 AAGGATCAACACTGTCAACATGG - Intronic
1201741692 Y:17331213-17331235 AAGGGTACAAACTGTCTAGCAGG - Intergenic