ID: 1115439486

View in Genome Browser
Species Human (GRCh38)
Location 14:33415806-33415828
Sequence AGTATCTAATAGGATGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115439486 Original CRISPR AGTATCTAATAGGATGTAAA GGG (reversed) Intronic
901403285 1:9029195-9029217 AATAGCTAAAAGTATGTAAATGG - Intergenic
901644911 1:10711329-10711351 AGGATCTAATAGCATGTAGTAGG - Intronic
909877840 1:80832374-80832396 ACTATCTAAAGGGATTTAAAAGG + Intergenic
911046510 1:93633284-93633306 AGATTCTAACAGGATGTAAATGG - Intronic
912004135 1:104875283-104875305 ATTAACTAAAAGGATCTAAAAGG + Intergenic
916626301 1:166559335-166559357 AGTCTCAAATAGTATGCAAATGG + Intergenic
917372416 1:174309125-174309147 TGTAGCTAATGGGATTTAAATGG + Intronic
919279365 1:195467474-195467496 AATACCTAATATAATGTAAATGG + Intergenic
921804503 1:219438149-219438171 TGTATTTGATAGGAAGTAAAGGG - Intergenic
921949707 1:220916682-220916704 AGTAATTAATATTATGTAAAGGG - Intergenic
923926460 1:238633463-238633485 AGTAACTGGTAAGATGTAAATGG - Intergenic
1062926346 10:1318312-1318334 AGTATCTTATGGGCTGTAAGAGG - Intronic
1065827772 10:29587522-29587544 AGTTTCTATTATTATGTAAATGG - Intronic
1065950087 10:30643781-30643803 AGTTTCTATTATTATGTAAATGG + Intergenic
1066512682 10:36119142-36119164 ACTACCTAATACAATGTAAATGG - Intergenic
1067923089 10:50480030-50480052 AAGAACTAATAGAATGTAAAAGG - Intronic
1068778710 10:60896418-60896440 AGAATCAAATAGGATTTAAATGG + Intronic
1069465379 10:68633791-68633813 AGTATAAAATATGATGAAAAAGG + Intronic
1070223585 10:74476719-74476741 AATATCAATTAGGATGTTAAGGG - Intronic
1070920841 10:80185014-80185036 AGTATCAAATAGGATGTATTTGG + Intronic
1071239545 10:83689858-83689880 AGTATCAAAAAGGATCTAGATGG + Intergenic
1072074173 10:91951994-91952016 GGTATATAATATGAAGTAAAAGG + Intronic
1072372874 10:94783204-94783226 ATTATGTCATAGGATGAAAATGG + Intronic
1076283852 10:129274737-129274759 TTTATCTAATAGGATGTGCAAGG + Intergenic
1076347180 10:129787269-129787291 AGTATCTAACAGGATGTTGTGGG - Intergenic
1077620159 11:3714526-3714548 AGTGACTACTAGGATGTAATAGG + Intronic
1079628363 11:22644158-22644180 AGTAGCAATTATGATGTAAAAGG + Intronic
1079774271 11:24504067-24504089 TGTATCTTATGGGAGGTAAATGG - Intronic
1084362314 11:68677017-68677039 AGATTCTAAGAGGCTGTAAACGG + Intergenic
1086592270 11:88529509-88529531 AGTATAAAATAGGAGGTCAAAGG + Intronic
1087843433 11:102943856-102943878 AGTATAAAATAGTATGAAAATGG - Exonic
1088837970 11:113594671-113594693 AATACCTAATACAATGTAAATGG - Intergenic
1091272305 11:134326022-134326044 AGTATCTAATAGGTAGTAACAGG - Intergenic
1091961344 12:4697485-4697507 TCTATTTAATAGGGTGTAAAGGG + Intronic
1093379272 12:18471945-18471967 AGTATCTAATTTGATATAAATGG - Intronic
1093821185 12:23619726-23619748 AGTAGCCAAAAGGAAGTAAATGG - Intronic
1096631566 12:52930175-52930197 GGCTTCTAATTGGATGTAAAGGG - Intronic
1099920421 12:88950695-88950717 AGTTTCTAATATGAAGGAAAAGG - Intergenic
1104272022 12:127290816-127290838 ACTATCTAATAGTTTGGAAAAGG - Intergenic
1106148840 13:27078287-27078309 GGTACCTAATACAATGTAAATGG - Intronic
1107046719 13:36000563-36000585 GGTATTTAATGGTATGTAAATGG - Intronic
1107278838 13:38709518-38709540 AATATATAATATAATGTAAAAGG + Intronic
1107974631 13:45677539-45677561 TGAATCTAATAGGATTTGAAAGG + Intergenic
1108085643 13:46789056-46789078 ATTAGCTAATTTGATGTAAATGG + Intronic
1108219718 13:48220930-48220952 GGTATCTAATAGGAAACAAAAGG + Intergenic
1110422107 13:75323164-75323186 AATATCTAAGAAGATGTTAATGG + Intronic
1112416641 13:99208449-99208471 AGGATTCAATAGGAAGTAAAAGG + Intronic
1113017021 13:105838861-105838883 TGTGTTTAATAGGATGTGAAGGG - Intergenic
1115095245 14:29627587-29627609 AAAATCTGATAGGATGTAATAGG - Intronic
1115439486 14:33415806-33415828 AGTATCTAATAGGATGTAAAGGG - Intronic
1115634503 14:35278566-35278588 AGTATCCAATAGGATGCCAGTGG + Exonic
1118129144 14:62942741-62942763 ATTTTCAAATAGGATGTAATTGG - Intronic
1119490461 14:75027971-75027993 AATCTCTAAAAGGATATAAATGG + Intronic
1123960204 15:25390557-25390579 AGTATATAATATGCTGGAAAAGG + Intronic
1124260012 15:28180822-28180844 AATACCTAATACAATGTAAATGG - Intronic
1125851742 15:42910729-42910751 AGTAACTATCTGGATGTAAAAGG + Intronic
1126223402 15:46241483-46241505 AGTATCTTAAAGTATGTAAAAGG - Intergenic
1127364073 15:58270544-58270566 AGTAACTAAAATGATGTAAAGGG - Intronic
1127655083 15:61048146-61048168 AGTTTCAAATAGAATTTAAAGGG - Intronic
1127720732 15:61696478-61696500 AGCACCTAATACAATGTAAATGG + Intergenic
1136467136 16:30452302-30452324 AATACCTAATACAATGTAAATGG - Intergenic
1137328430 16:47464798-47464820 AGTACATAATAGGTTTTAAATGG - Intronic
1138871085 16:60887391-60887413 AATATATAATACAATGTAAATGG - Intergenic
1138899450 16:61251298-61251320 AATATCTAATACAATGTAAATGG - Intergenic
1139725766 16:68896739-68896761 AGTATCTTAAAGAATGTCAATGG - Intronic
1140703897 16:77608074-77608096 AATACCTAATACAATGTAAATGG + Intergenic
1141884684 16:86883480-86883502 AATACCTAATACAATGTAAATGG + Intergenic
1143332436 17:6147637-6147659 GGTATCTAAAATGATGTGAAGGG - Intergenic
1145827053 17:27884947-27884969 AGGAGATAATGGGATGTAAATGG - Intronic
1148045754 17:44743183-44743205 AGGAGCTAAGAGGCTGTAAAGGG + Intronic
1148278059 17:46323904-46323926 AGTACCTAATACAGTGTAAATGG - Intronic
1148289858 17:46435569-46435591 AGAATCTAAGAGGATCTACATGG - Intergenic
1148300268 17:46541759-46541781 AGTACCTAATACAGTGTAAATGG - Intronic
1148312026 17:46653141-46653163 AGAATCTAAGAGGATCTACATGG - Intronic
1149763723 17:59256557-59256579 AGTATCTACTAGTAGGGAAATGG + Intronic
1150402235 17:64867562-64867584 AGTACCTAATACAGTGTAAATGG + Intronic
1150722874 17:67628451-67628473 AGCAACTATAAGGATGTAAAGGG + Intronic
1153241050 18:3031638-3031660 AGTATCTAATAATCTGGAAAGGG - Intergenic
1155019490 18:21882206-21882228 AAAATCAAATAGAATGTAAATGG - Intergenic
1158553293 18:58455284-58455306 AGTTTCTAAAAGGAAGAAAAGGG + Intergenic
1159007834 18:63028633-63028655 AGTAACTAATACGGTATAAATGG - Intergenic
1159172847 18:64795377-64795399 AGTATCTATTAGGAGGTTAAGGG - Intergenic
1159215866 18:65389439-65389461 AATATCTAACACAATGTAAATGG + Intergenic
1164148215 19:22525912-22525934 AGTATATAAAAGTGTGTAAATGG + Intronic
1167825635 19:51970396-51970418 AATATCTAATACAATGTAAATGG + Intronic
925840841 2:7990283-7990305 AGCATCTCATAGGAGGTGAAGGG - Intergenic
927352353 2:22131592-22131614 AGTATATGAGAGGATGTGAATGG + Intergenic
932055014 2:68434435-68434457 TTTATCTAACAGGAGGTAAATGG - Intergenic
933183087 2:79249323-79249345 ACTATCTAATAGCACTTAAAAGG + Intronic
935757345 2:106286648-106286670 AGAAGCCAATAGGATGTGAAAGG + Intergenic
935819478 2:106879959-106879981 TGTATATAATAGTATGTAATTGG - Intronic
937776682 2:125785988-125786010 AGTCTCTAATTGGATGCTAAGGG - Intergenic
940219198 2:151334233-151334255 ACAATCTAAGAGGATGTCAATGG - Intergenic
942036837 2:172018363-172018385 AGCAGATAATAGGAAGTAAATGG + Intronic
942518836 2:176781790-176781812 AGTATCTGACAGGAAGTAGAGGG + Intergenic
942631817 2:177958260-177958282 AGTACATAAAAGGATGTAAAAGG + Intronic
942839313 2:180340449-180340471 AGTATCTACTAGGAAGAGAAGGG + Intergenic
943873358 2:193030714-193030736 AATATCTAAAAGGATATAATTGG + Intergenic
945538265 2:211048374-211048396 AGTATCTAATTGAAAATAAAAGG - Intergenic
945693436 2:213071220-213071242 AGTATCTAGTAAAATATAAATGG - Intronic
947292289 2:228589554-228589576 AGTATCTAATATCATCTAGAGGG - Intergenic
1171108784 20:22461464-22461486 AATATCTAATACAATGTAAATGG - Intergenic
1176864439 21:14037027-14037049 AGTATCTTAAAGTATGTAAAAGG - Intergenic
1177831331 21:26142433-26142455 AGTATCTAATGGTATTAAAATGG - Intronic
1179968972 21:44823968-44823990 AGTATCTAAAAAGTGGTAAAGGG + Intergenic
1180677137 22:17594900-17594922 AATAGCTAATACGATGTAAATGG + Intronic
1181004718 22:20007468-20007490 AGTATTTATTCTGATGTAAATGG - Intronic
1184622666 22:45694097-45694119 AGTATCTAGTGTGATGAAAATGG + Intronic
949342859 3:3048308-3048330 AATACCTAATATAATGTAAATGG - Intronic
952370376 3:32717182-32717204 AGTCTCTGAAAGCATGTAAAAGG + Exonic
954407813 3:50355279-50355301 AGTAGCTGAGAGGATGTCAAGGG + Exonic
955024060 3:55150461-55150483 AATACCTAATACAATGTAAATGG + Intergenic
955329394 3:58034625-58034647 TGTATCCATTAGGATGTATATGG + Intronic
955759974 3:62269345-62269367 AGCATCTAATAGAATTTAACTGG + Intronic
956368081 3:68527466-68527488 AGTATATATTATGATATAAAAGG - Intronic
957524577 3:81363091-81363113 AATACCTAATACAATGTAAATGG + Intergenic
957742142 3:84284190-84284212 AATATCTAAAAGGAAATAAAAGG - Intergenic
960469397 3:118042572-118042594 AGTCTCTTATAGGAAGTATATGG - Intergenic
961589146 3:127962502-127962524 AGAAATTAATAGGATGGAAAGGG - Intronic
965679901 3:171239447-171239469 AGTATCTAAAAGGTGGTGAATGG - Intronic
966386133 3:179400490-179400512 AGTAGGTAATAGCATATAAATGG - Exonic
966977056 3:185094028-185094050 AGTACCTAATACAAAGTAAATGG + Intronic
967668895 3:192208067-192208089 AGTAGCTAATGAGCTGTAAAGGG - Intronic
968438461 4:608707-608729 AATATGTAAAAGGATGTAAAAGG + Intergenic
971074345 4:23130439-23130461 AGGATTACATAGGATGTAAATGG - Intergenic
971195425 4:24468918-24468940 AACATCTAATACCATGTAAAAGG - Intergenic
972037394 4:34543465-34543487 AATAAATATTAGGATGTAAATGG - Intergenic
972177305 4:36423582-36423604 AGAATATATTAGGATATAAAAGG + Intergenic
973751911 4:54029150-54029172 AATATCAAATATGATGTGAAAGG + Intronic
973989349 4:56388509-56388531 AGGGTCTAATCGGATGTAAGAGG - Intergenic
974259528 4:59507584-59507606 ACTATGTAATTGGGTGTAAAGGG - Intergenic
974576530 4:63731087-63731109 AGTATCTAAGAGTATTCAAAAGG - Intergenic
975469633 4:74750184-74750206 GGTATATAATAGAAAGTAAAAGG + Intronic
976264844 4:83180790-83180812 AGTATCTATTAGCTTGTAACAGG - Intergenic
980689231 4:136271810-136271832 AGTACCTAAAAGAGTGTAAAGGG + Intergenic
980698463 4:136391855-136391877 TGTATATATTAGGATGTGAATGG + Intergenic
982969017 4:161956551-161956573 AGTATCTATTAGGTTGGTAAAGG + Intronic
983709894 4:170701063-170701085 AATATCTACTTGGATTTAAATGG - Intergenic
989075443 5:37560745-37560767 AATAGCTAATAGGATGTCCAGGG - Intronic
989409718 5:41104982-41105004 ATTCTCTAATAGCATGTAAATGG + Intergenic
989568195 5:42922319-42922341 AGTATCTAATATATTGTAAATGG + Intergenic
989735535 5:44699741-44699763 TGTATATCATAGGATGTAGAGGG - Intergenic
989840177 5:46055352-46055374 AGTATTTAATAGGATCTGAAAGG + Intergenic
991018335 5:61955116-61955138 AATAACTAAAAGAATGTAAATGG - Intergenic
992061018 5:73047751-73047773 AATACCTAATACAATGTAAATGG + Intronic
992618173 5:78565768-78565790 ATTATCTGATAGGAGGAAAAAGG - Intronic
993238770 5:85351805-85351827 AGTATCTACGTGGATGTAACTGG + Intergenic
994237293 5:97377999-97378021 TCTAGCTAATAAGATGTAAATGG - Intergenic
994723672 5:103409648-103409670 AGTGTCTAATTGTATGGAAATGG + Intergenic
994996879 5:107075394-107075416 AGTTTACAATAGGATCTAAATGG - Intergenic
996115913 5:119618277-119618299 AATAACTAATAGAATGTAATTGG - Intronic
998178246 5:139915244-139915266 ATTACCAAATAGGCTGTAAATGG + Intronic
999020855 5:148163938-148163960 AGTATCTTATAGGATGTCTAAGG - Intergenic
999526993 5:152417600-152417622 AATACCTAATAAAATGTAAATGG + Intronic
1000804692 5:165775596-165775618 AGCATGTAATAGCAAGTAAAAGG + Intergenic
1003886864 6:10529525-10529547 AGTATCTGAAGGGATTTAAAGGG + Exonic
1003893711 6:10586603-10586625 AGCATCTGAAAGGATTTAAAGGG + Intronic
1004792572 6:19043266-19043288 TAGATCCAATAGGATGTAAAAGG + Intergenic
1004961935 6:20799929-20799951 AGTATCTACTAACATGCAAAAGG - Intronic
1005168146 6:22949704-22949726 AGGACATAAAAGGATGTAAAAGG - Intergenic
1006660281 6:35635891-35635913 ATTATCTAAAAGGTTGTTAAAGG - Intronic
1009165342 6:60334394-60334416 AGCATGTGATAGTATGTAAATGG + Intergenic
1009287607 6:61841130-61841152 AGTATCTAACAAGCTGTAACTGG + Intronic
1009740643 6:67740534-67740556 ATTGTCTAAAAGGAGGTAAAAGG - Intergenic
1009944543 6:70328024-70328046 AGTATCTAATTTAAAGTAAAAGG - Intergenic
1010450295 6:75994790-75994812 AGTATCTAATATGGTTTATATGG - Intronic
1011486240 6:87844833-87844855 ACTAACTAACAGGATGTACAGGG - Intergenic
1012092395 6:94915974-94915996 AGTATCCAATAAGATAAAAAAGG + Intergenic
1012226464 6:96709389-96709411 AATATCTAATACAATGTAAGTGG - Intergenic
1013073093 6:106746769-106746791 CGTAACTAAGAGGATGAAAAAGG - Intergenic
1013889285 6:115006777-115006799 AGTATTTAATGGGATGGACATGG - Intergenic
1014096039 6:117463267-117463289 AATAAGTAAAAGGATGTAAAAGG - Intronic
1014272702 6:119350389-119350411 TGTGTCTCTTAGGATGTAAAAGG - Intergenic
1014663303 6:124201136-124201158 AATATGTATTAGTATGTAAAAGG - Intronic
1015343571 6:132129977-132129999 AATACCTAATACAATGTAAATGG + Intergenic
1015407348 6:132852985-132853007 ATAATCTAATTGGATGAAAATGG - Intergenic
1017545029 6:155441406-155441428 AGCATATCATATGATGTAAATGG - Intronic
1020171658 7:5849751-5849773 TGTATCTAAAAGGATGTCAGCGG - Intergenic
1021164484 7:17319088-17319110 AGTATCTAATAGGATTACTATGG - Intronic
1021490049 7:21209890-21209912 AGTCTCTAACATGATTTAAAAGG - Intergenic
1021638408 7:22714004-22714026 AGAATCTCAGAGGATTTAAACGG + Intergenic
1022993385 7:35730051-35730073 ATTATGTAATAAGAGGTAAATGG - Intergenic
1024256244 7:47542091-47542113 AGAATCTAATAGGCTGTCACTGG + Intronic
1026671432 7:72393981-72394003 AGAATCACATAGGAAGTAAATGG + Intronic
1027413629 7:77949660-77949682 AGTAGCTAAAAGTATGAAAAAGG - Exonic
1027934577 7:84586541-84586563 AGTAGATAATTGGATGAAAAGGG - Intergenic
1028219456 7:88179343-88179365 AGTATTTAATAATATTTAAATGG + Intronic
1028505393 7:91564995-91565017 AGTACATAATATGATGTCAAGGG + Intergenic
1030633623 7:111923142-111923164 AATACCTAATACAATGTAAATGG - Intronic
1031557015 7:123190068-123190090 AATATCAAATAGAATATAAAAGG - Intronic
1032309410 7:130769533-130769555 ACAATCTAAAAAGATGTAAATGG + Intergenic
1032642976 7:133790227-133790249 AGCATGCAATAGGATGTAGATGG + Intronic
1036080631 8:5551881-5551903 AGTAACTAGTAAGATGAAAATGG - Intergenic
1037857150 8:22380029-22380051 AGTATTGAATACAATGTAAATGG - Intronic
1038108180 8:24461354-24461376 AGTCTCTAATGGAATGTTAATGG + Intronic
1039034444 8:33344574-33344596 AGCAGCTAATTGGATGAAAACGG + Intergenic
1041266431 8:56069937-56069959 AATACCTAATACAATGTAAATGG - Intronic
1043658486 8:82704444-82704466 AGTAACTAAAAGAATGTAATTGG + Intergenic
1043760145 8:84058324-84058346 AATAACTAAAAGGATGTAAGTGG - Intergenic
1043848989 8:85194371-85194393 AGAATCTACTAGAATGTACATGG - Intronic
1043963891 8:86449716-86449738 AGCATCTAAGAGGGTGAAAATGG - Intronic
1045370960 8:101522387-101522409 AGTATATAGTAGGATGTGCATGG + Intronic
1045527423 8:102953143-102953165 AGCATTTAATAGGGAGTAAACGG - Intronic
1047007081 8:120631539-120631561 ACTTTCTAATAGGCAGTAAATGG - Intronic
1048675416 8:136773219-136773241 AGTGTTTAATAAGATGTAAAAGG + Intergenic
1050733841 9:8740103-8740125 ATTATTTCATAGAATGTAAAGGG + Intronic
1051483471 9:17584061-17584083 AGTCTCTAATAGGCTGCAAGGGG + Intronic
1051785748 9:20741345-20741367 AGTATCTCATATACTGTAAATGG + Intronic
1051785994 9:20744189-20744211 AGTTTCTAAGAGGATGTTCAAGG - Intronic
1055290374 9:74776770-74776792 AGTATATAATATGATATAAGAGG + Intronic
1056972211 9:91215422-91215444 AATACCTAATATAATGTAAATGG + Intronic
1058246920 9:102638289-102638311 ATACTCTATTAGGATGTAAATGG - Intergenic
1058346091 9:103964719-103964741 AGTATTTAATAGCAAGCAAATGG + Intergenic
1058481154 9:105396736-105396758 ACTATGAAATAGGATGCAAATGG - Exonic
1059934793 9:119298833-119298855 AGCAGGTAATAGTATGTAAAGGG - Intronic
1060639630 9:125227723-125227745 AGCAGCCTATAGGATGTAAAAGG + Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1190778437 X:53574193-53574215 AGTATGTAAAAGGAGGGAAATGG - Intronic
1196517991 X:116636124-116636146 AATAACTAATAGAATGTAATTGG + Intergenic
1196962851 X:121022656-121022678 AATACCTAATACAATGTAAATGG + Intergenic
1199251067 X:145662310-145662332 AGTATCTAATAGGAAGAACCAGG - Intergenic