ID: 1115439668

View in Genome Browser
Species Human (GRCh38)
Location 14:33418385-33418407
Sequence GCTTGTATGCTGCTGGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115439659_1115439668 25 Left 1115439659 14:33418337-33418359 CCGAGTTTGCCATGAAGAATGAT 0: 1
1: 0
2: 1
3: 50
4: 539
Right 1115439668 14:33418385-33418407 GCTTGTATGCTGCTGGTAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
1115439660_1115439668 16 Left 1115439660 14:33418346-33418368 CCATGAAGAATGATAATAGATAG 0: 1
1: 0
2: 0
3: 19
4: 240
Right 1115439668 14:33418385-33418407 GCTTGTATGCTGCTGGTAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
1115439658_1115439668 26 Left 1115439658 14:33418336-33418358 CCCGAGTTTGCCATGAAGAATGA 0: 1
1: 0
2: 1
3: 13
4: 183
Right 1115439668 14:33418385-33418407 GCTTGTATGCTGCTGGTAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115439668 Original CRISPR GCTTGTATGCTGCTGGTAGC AGG Intronic
900945377 1:5828300-5828322 GCTGGGAGGCTGCTGGGAGCGGG + Intergenic
902592552 1:17485469-17485491 GCTTGCCCCCTGCTGGTAGCAGG + Intergenic
912344279 1:108950391-108950413 GAATGTCTGTTGCTGGTAGCTGG - Exonic
919698229 1:200601988-200602010 TCTTCTATGTTGCTGGCAGCGGG + Exonic
924170069 1:241329791-241329813 TCTTGTGTGCTGCTGGTGGATGG + Intronic
924653240 1:245949191-245949213 GCTTGGGTGCTGGTGGTAGGTGG - Intronic
1064168963 10:13012576-13012598 GCTTATATACTGCTGGTGGGAGG + Intronic
1065468329 10:26049479-26049501 GGTTGTATGCTGATGGAAGGAGG + Intronic
1073467915 10:103704974-103704996 GCCTGTGTCCTGCTTGTAGCAGG + Intronic
1081673146 11:44952921-44952943 GCTTGCATGCTGCTAGTGACAGG - Intergenic
1086306642 11:85486796-85486818 GCTTGGATGCTGGTAGTAGCAGG - Intronic
1091219373 11:133920937-133920959 GGCTGTATGCTGGTGGTGGCAGG + Exonic
1093798671 12:23344967-23344989 GCTTGAATTCTGCTTGCAGCAGG - Intergenic
1097995354 12:65882168-65882190 GCCTTTCTGCTGCTGGTAGGAGG + Intronic
1101722493 12:107362283-107362305 GCTTGCTTCCTGCTAGTAGCTGG + Intronic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1109841090 13:67917227-67917249 GCTTATATGCTTTTGGTATCAGG - Intergenic
1111754880 13:92380383-92380405 TGTTGTCTGCTGCTGGTAGCAGG + Intronic
1112166341 13:96924244-96924266 GCTTTTATGCTGTTGGTGGGAGG + Intergenic
1112609019 13:100937797-100937819 GCTTATATGCTGTTGGAGGCAGG - Intergenic
1115439668 14:33418385-33418407 GCTTGTATGCTGCTGGTAGCAGG + Intronic
1117187029 14:53250200-53250222 GCTTGCAGGCTGCAGGTAGTTGG + Intergenic
1119536549 14:75407681-75407703 GCTTTTATACTGTTGGTGGCAGG - Intergenic
1121432950 14:93900276-93900298 GCTTGTCTGCAGCTGGGGGCAGG - Intergenic
1126042594 15:44607180-44607202 ACTTGTATACTGCTTGTTGCTGG - Intronic
1128059711 15:64727477-64727499 ACTTGAAAGCTGCTGGGAGCTGG + Intergenic
1129925961 15:79364602-79364624 GCTTGTCTGCTCCTGGAACCTGG - Intronic
1130228165 15:82075826-82075848 GCTTCCATGCAGCAGGTAGCAGG + Intergenic
1130869841 15:87961901-87961923 TCTGGTATGCTCCTGGAAGCAGG - Intronic
1133428686 16:5716589-5716611 GCTTATATGCTGTTGGTAGGAGG + Intergenic
1135255754 16:20940373-20940395 ACTTGTAAAATGCTGGTAGCAGG + Intronic
1137274860 16:46926756-46926778 GCTGGGATACTGCTGGTGGCTGG - Intronic
1140461131 16:75140596-75140618 GTTTGTCAGCTGCTGGTGGCAGG - Intergenic
1141644415 16:85359573-85359595 GCTTGTAAGCTGCTTGAAGAGGG + Intergenic
1144037534 17:11381101-11381123 GTTTGTAGGCTTGTGGTAGCTGG - Intronic
1148018388 17:44538461-44538483 GCTGGTATGCTGCTGGTGAGGGG - Intergenic
1150656874 17:67045041-67045063 GCATGTGTGGTGCTGGTGGCTGG + Intronic
1157916401 18:51668061-51668083 GCTGGTGTGATGCTGTTAGCTGG - Intergenic
1160378708 18:78432579-78432601 CCTTGTATGCTGATTGAAGCGGG - Intergenic
1164544459 19:29148042-29148064 GTTTGGATGCAGCTGGTTGCAGG + Intergenic
1168271916 19:55254733-55254755 GCCAGCCTGCTGCTGGTAGCAGG - Intronic
925187387 2:1858544-1858566 GGATGTGTGCAGCTGGTAGCAGG + Intronic
926324205 2:11770329-11770351 CCTGGGATGCTGCTGGAAGCTGG + Intronic
927647392 2:24886679-24886701 GCTTTTGCGCTGCTGGGAGCTGG - Intronic
931709136 2:64972677-64972699 CCTTGTAAGCTGATGGCAGCAGG + Intergenic
933785644 2:85839069-85839091 TCTTGGATGCTGCTGCTAGGCGG - Intergenic
935528065 2:104197207-104197229 GCTTGCCTGCTGCTGGTCACAGG + Intergenic
936766752 2:115859372-115859394 GCTTGTGTGCTGATGGTGGCAGG + Intergenic
937009777 2:118552157-118552179 GTAAGAATGCTGCTGGTAGCTGG - Intergenic
940436891 2:153666332-153666354 GCTTGCATGCTGTTGGTTGCAGG - Intergenic
946363659 2:219235272-219235294 GTTCGTCTGCTGCTGGAAGCAGG + Exonic
947582322 2:231328695-231328717 GATTGTATGCTACTGGTAGAGGG - Intronic
947713988 2:232330803-232330825 GCTAGTGTGCTCCTGGGAGCAGG - Intronic
1168801407 20:645706-645728 GGGTGTAACCTGCTGGTAGCCGG - Intergenic
1169343983 20:4815757-4815779 GCTTGCTGGCTGCTGGCAGCTGG - Intronic
1170108690 20:12780984-12781006 ACTTATATGCTGCTGGTGGGAGG - Intergenic
1170244250 20:14203870-14203892 GCTTGGGTGCTGGTGGTGGCAGG + Intronic
1171146496 20:22788323-22788345 GCTAATGTACTGCTGGTAGCTGG + Intergenic
1172018006 20:31890786-31890808 GGTTGTATGCTGTTGGCAGAGGG + Intronic
1175197189 20:57252347-57252369 GCTTAAATGCTGCTTGGAGCAGG - Intronic
1175257414 20:57655680-57655702 GGTTGGAGGCTGCTGGGAGCAGG - Intronic
1175517709 20:59579420-59579442 GCTGGGATGCTGCGGGGAGCAGG + Intronic
1182283666 22:29231951-29231973 GCTTCCATGCTGCTGGGAGCAGG + Intronic
1183073262 22:35410956-35410978 GCTTGCATACTTCTGGTAACAGG + Intronic
949150180 3:757479-757501 GCTTGAATGCTGGTAGTGGCAGG + Intergenic
952873196 3:37920372-37920394 ACTTGTCTGGTGCTGGAAGCAGG + Intronic
961269342 3:125677063-125677085 GCATTTATAATGCTGGTAGCAGG + Intergenic
961476597 3:127150701-127150723 GCTGCTATCCTGCTGGGAGCCGG - Intergenic
965364655 3:167783753-167783775 GCCTCTCTGCTGCTGGTTGCTGG - Intronic
967929048 3:194677296-194677318 GCTTGAATGCCTCTGGTGGCAGG - Intergenic
968187988 3:196646424-196646446 CCTTGCATGCTGGTGGTGGCTGG - Intronic
968917573 4:3503274-3503296 ACATGTGAGCTGCTGGTAGCTGG - Intergenic
968974823 4:3816560-3816582 GCCTTTGTGCTGCAGGTAGCAGG + Intergenic
970877346 4:20886422-20886444 GTGTGTATTCTGCAGGTAGCTGG + Intronic
972656866 4:41072236-41072258 GTGTGTATCCTGCTGGTAACTGG + Intronic
972883717 4:43458449-43458471 GCTTGTATCCACCTGGCAGCTGG + Intergenic
975427903 4:74252074-74252096 ACTTGTATGGTGCTGGGTGCTGG + Intronic
978774839 4:112495486-112495508 GCTTGTATGCTGCTGCAATGAGG - Intergenic
982774416 4:159427382-159427404 GCTTGTCTGCTTCTGGAACCTGG - Intergenic
984523878 4:180833103-180833125 GGTTGTTTGCTTCCGGTAGCAGG + Intergenic
984584735 4:181550326-181550348 GCTTGTTTGCTGTAGGTAGGTGG - Intergenic
986542695 5:8863737-8863759 GCTTGTCTGCTCCTGGAACCTGG - Intergenic
987552650 5:19403859-19403881 ATAAGTATGCTGCTGGTAGCAGG - Intergenic
988034433 5:25807687-25807709 GCATGAGTGCTGGTGGTAGCAGG + Intergenic
990101489 5:52195141-52195163 GTTTGTGTGCTGCAGCTAGCTGG - Intergenic
993520056 5:88889459-88889481 GCTCGGAGGCTGCTGGTAGGGGG + Intronic
994657327 5:102609663-102609685 ACTTGTATGCTGAGGGTTGCTGG + Intergenic
997930035 5:138065218-138065240 GTCCGCATGCTGCTGGTAGCTGG - Intergenic
1002288953 5:178186716-178186738 GCTTGTATGCTGCAGCTGGATGG - Intergenic
1008205595 6:48652973-48652995 GCTTATATACTGCTGATAACTGG - Intergenic
1016727699 6:147394470-147394492 TCTTGTATCCTGATGATAGCTGG - Intergenic
1018146509 6:160895540-160895562 TGTTGTATGCTGCTGGTATTTGG - Intergenic
1019675248 7:2307720-2307742 GCTTGGAGGCTGCAGGTAGGAGG - Intronic
1019928982 7:4210997-4211019 GCTTGGGTGGTGCTGGTGGCTGG + Intronic
1020516830 7:9132437-9132459 ACTTATATGCTGCTGGTAAGAGG + Intergenic
1021289670 7:18827455-18827477 GCTCATATGCTGCTTGTAGAAGG - Intronic
1024528654 7:50372136-50372158 GCTTGTATTCTCCTCCTAGCTGG + Intronic
1032203311 7:129839219-129839241 GCTTGTATTCTTCTGGTCGGTGG + Exonic
1032942113 7:136805979-136806001 GCTGGTCTGCTGCTGTTTGCAGG + Intergenic
1033976665 7:147110982-147111004 GCTTTTATGCTGTTGGTGGGAGG - Intronic
1046038157 8:108869191-108869213 GATTGTATGATGCTGCTATCTGG - Intergenic
1046379327 8:113432921-113432943 GCGTGTGTGCTGCTGGGAGGAGG - Intronic
1047858272 8:128936537-128936559 GGTTGCATGGTGGTGGTAGCTGG + Intergenic
1048444075 8:134480357-134480379 GCTTGCAGTCTACTGGTAGCTGG - Intronic
1048495046 8:134928188-134928210 GCCTTTATGCAGCTGGAAGCAGG - Intergenic
1048612220 8:136035309-136035331 GCTTGTAGGCTGCTGATTGTGGG - Intergenic
1052694113 9:31854313-31854335 GCTTGTGTGCTGGTGGTGGAGGG - Intergenic
1055855387 9:80680094-80680116 GCTTTTGTTCTCCTGGTAGCAGG - Intergenic
1059312825 9:113400369-113400391 GCCTGGCTGCTGTTGGTAGCAGG + Intronic
1060233282 9:121841310-121841332 ACCTGTATCCTGCAGGTAGCAGG + Intronic
1061254548 9:129446811-129446833 GCTTGCGTTTTGCTGGTAGCTGG + Intergenic
1188310945 X:28615886-28615908 GCTTGAATGCTGGTGGTAGAAGG - Intronic
1189364551 X:40378333-40378355 GCTGGTAGGATGCTGGTAGGTGG - Intergenic
1192208999 X:69115450-69115472 GCTTGTGTGCTGCTGGCTGTGGG - Intergenic
1195086269 X:101417262-101417284 GCTTGCATTCTTCTGTTAGCTGG + Intergenic