ID: 1115441689

View in Genome Browser
Species Human (GRCh38)
Location 14:33443088-33443110
Sequence CAGTGTTAACTGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115441689 Original CRISPR CAGTGTTAACTGAGGGAAGC TGG (reversed) Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
903974673 1:27141699-27141721 CAGTGCTCAGTCAGGGAAGCGGG + Intronic
904045391 1:27605262-27605284 AAATGTTAACTGAGGTATGCAGG + Intergenic
904596684 1:31650940-31650962 CAGGGTTAACTGAGAATAGCTGG + Intergenic
905212015 1:36380896-36380918 CAGGGTTTACTGAACGAAGCTGG + Intronic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
909729050 1:78871762-78871784 GAGTGATAACTTAGGGAATCCGG - Intergenic
911029302 1:93469067-93469089 AAAAGTTAACTGAGGTAAGCAGG - Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921273022 1:213489657-213489679 CAGTGGCAACTCAGGGAGGCAGG + Intergenic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924219488 1:241858049-241858071 CAGTGATAAATGAGGGAATAGGG + Intronic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1064145823 10:12825708-12825730 CAGTGTCAGCTGAGGGATTCTGG - Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1065092376 10:22247739-22247761 CAGTGTGAACTGAGTGAGCCAGG - Intergenic
1072618690 10:97066148-97066170 CTGTGATAAGTCAGGGAAGCAGG + Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073424586 10:103448778-103448800 AAGTGTTAACTTAGAGAAGCAGG - Intronic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1074683123 10:115930874-115930896 AAGTGCTAACTGAGAGAAGATGG - Intronic
1076516198 10:131045699-131045721 CACTGTTAAATAAGGGAAACAGG + Intergenic
1077660718 11:4066172-4066194 CAGAGCTAACCCAGGGAAGCTGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1078644643 11:13129207-13129229 CAGTATTAACTGAGGAAAAATGG + Intergenic
1079218873 11:18540903-18540925 CAGTGTTTATTGAGCAAAGCAGG + Intronic
1079523282 11:21354377-21354399 AAGTTTTAACTAAGTGAAGCGGG - Intronic
1079743930 11:24101252-24101274 CACTGTGACCTGAGGGGAGCAGG - Intergenic
1080216072 11:29842594-29842616 TAATATTAACTGAAGGAAGCTGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083627687 11:64079894-64079916 CAGTCGTAAATGAGGGAGGCAGG + Intronic
1084082870 11:66840433-66840455 CAGTGATAACTGATGCAAGCAGG - Intronic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1085158909 11:74322963-74322985 CAGTTTTGACTGAGGTCAGCTGG - Intergenic
1087313934 11:96584191-96584213 CAGTGATAACTGAGGTAAGATGG - Intergenic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1089048689 11:115526892-115526914 ATATGTTAACTGAGGGAGGCTGG - Intergenic
1090181037 11:124699635-124699657 TAGATTTTACTGAGGGAAGCAGG - Intergenic
1091131396 11:133150017-133150039 CAGTGTTAATCAAGGGATGCTGG - Intronic
1094409387 12:30152720-30152742 CAGTGCTAACTCAGTGAAGCAGG + Intergenic
1096417532 12:51426578-51426600 AAATGTTAACTGAGGGAAGAGGG + Intronic
1097945713 12:65365862-65365884 CAGTGGTAACTGGGCCAAGCTGG + Intronic
1097994496 12:65872741-65872763 CAGTGATAATGGAGGTAAGCTGG - Intronic
1098297773 12:69021627-69021649 CATTATTTACTGAGGGAATCAGG + Intergenic
1101223668 12:102666410-102666432 TTGTTTTAACTGTGGGAAGCAGG - Intergenic
1104882915 12:132084616-132084638 GAGTGTTCACTGAGGGAGGTGGG - Intronic
1105584797 13:21733968-21733990 GAAGCTTAACTGAGGGAAGCTGG - Intergenic
1106579190 13:31003139-31003161 CGGGGTGAACTGAGTGAAGCAGG - Intergenic
1106634941 13:31518594-31518616 CAGTGGAATCTGAGGAAAGCTGG + Intergenic
1107213980 13:37893729-37893751 CAGTTTTGAATGAGTGAAGCAGG - Intergenic
1109288013 13:60434903-60434925 CAGTCTTAATTGAGGTAATCAGG - Intronic
1111128021 13:83936956-83936978 CAGCATTGACTGAGGGAAACAGG - Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118337016 14:64862131-64862153 CAGTGTTAACTGTGTTAAGTGGG - Intronic
1118726384 14:68631967-68631989 GAGGGTTTACTGAGTGAAGCAGG + Intronic
1121505960 14:94476845-94476867 CAGTGTTTACTTTGGGAAACGGG - Intronic
1126119146 15:45235811-45235833 CAGGGTCTACTGAGGGAAACAGG + Intergenic
1127133566 15:55895504-55895526 CTGTGGTAGCTGAGGAAAGCTGG + Intronic
1128664914 15:69531020-69531042 CAGGGTAAACTGAGGGAAATGGG - Intergenic
1128679372 15:69636855-69636877 CAGTGTAAACAGAGAGCAGCAGG + Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1131625261 15:94111422-94111444 CAGTGTTAACTGAACTAATCTGG - Intergenic
1132321439 15:100928444-100928466 CAGTGTTCCCTGAGTGAGGCTGG - Intronic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1135776683 16:25262687-25262709 TAATGTTAACTCAGTGAAGCAGG + Intergenic
1136146279 16:28318307-28318329 TTGTGCTAACTGAGGGCAGCAGG + Intronic
1139766715 16:69236745-69236767 CAGTGGAAACTGAGGGGAGTAGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1144044999 17:11447484-11447506 CTGTGTTAACTCAAGGAAGGTGG - Intronic
1144074221 17:11702375-11702397 TACTGTTAACTGAGGGAAGGAGG - Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155586580 18:27373156-27373178 CAGTGTTAAATTAGACAAGCTGG - Intergenic
1156872005 18:41955865-41955887 CAGTGTTTAGTCAGGGAAGTTGG + Intronic
1157359653 18:46965269-46965291 CATTGTTAACTGAAGAAAACTGG + Intronic
1157361246 18:47024788-47024810 CATTGTTAACTGAAGAAAACTGG + Intronic
1157362236 18:47030703-47030725 CATTGTTAACTGAAGAAAACTGG + Intronic
1157836815 18:50911500-50911522 GAGAGTTAACAGAGGGAAGTAGG + Intronic
1158414958 18:57242133-57242155 CAGTGGTAACTCAGAGAGGCAGG + Intergenic
1158678747 18:59547254-59547276 GAGGGTTATCTGAGGGGAGCAGG + Intronic
1160940278 19:1617615-1617637 CAGAGTTCACTGTGGGGAGCGGG - Intronic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162965965 19:14156241-14156263 CAGTGCTCACTGAGGGAGGCAGG - Intronic
1163429452 19:17258377-17258399 CAGTGTTCACTGTGGGACACTGG + Exonic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1168666733 19:58210060-58210082 CAGTGCTCCCTGAGGTAAGCGGG + Exonic
1168673042 19:58255897-58255919 CCTTGGTAACTGAGGGCAGCTGG - Intronic
925275609 2:2645818-2645840 CAGAGCCAACTGAGGCAAGCAGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
931222657 2:60302075-60302097 CAGAGTGAACTTGGGGAAGCGGG + Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932183814 2:69674033-69674055 CAGTGTTCACCGAGGCACGCAGG - Intronic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
940258927 2:151760530-151760552 CAGGGTTATCTGTGGGGAGCCGG + Intergenic
941122367 2:161545654-161545676 TAGTGGTAACTGAGGGAGGCAGG + Intronic
941585092 2:167348757-167348779 CACTTTTAACTGAGGTAATCTGG - Intergenic
943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG + Intergenic
945451255 2:209999124-209999146 CATAGTTATCTGAGGGAAGTCGG - Exonic
946375544 2:219306859-219306881 CAGTATTAAATGAGGAAATCAGG - Intronic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
948885011 2:240878027-240878049 CAGTGGTGACTGTGGGAAGCCGG - Exonic
1169413315 20:5393317-5393339 AATTGTTAACTGAGGAAAGCAGG + Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171466190 20:25329409-25329431 CAGTGAAAACTGGGGGAAGCAGG - Intronic
1173423189 20:42921052-42921074 AAATGTTAAGTGAGGAAAGCAGG + Intronic
1175505812 20:59483460-59483482 CGATGTTAACTGAGGAGAGCTGG + Intergenic
1181409405 22:22708264-22708286 CAGTGTTCACTGTTGGCAGCAGG + Intergenic
1181417180 22:22768831-22768853 CAGTGTTCACTGTTGGCAGCAGG + Intronic
1183789113 22:40050597-40050619 CAGTCTTAACTGAGGGTGGATGG - Intronic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
949847849 3:8390100-8390122 CTCTGTTAACTGAGGGAACAGGG + Intergenic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
951913258 3:27773377-27773399 CAGTGTCCACTGTGGGAAACTGG - Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953518276 3:43618175-43618197 CACAGATAACTTAGGGAAGCTGG + Intronic
954223932 3:49171079-49171101 CAGTGTACACTGAGGCTAGCGGG - Intergenic
954639992 3:52092154-52092176 CAGTGTTTACTGGGGCAAGGAGG + Intronic
954844011 3:53538953-53538975 GAGTGGTGACTGAGGGAAGTGGG - Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
956359746 3:68435095-68435117 GGGTGTTAAATGATGGAAGCAGG + Intronic
961194557 3:124990688-124990710 AGGTGTGAACTGAGGGAAGTGGG + Intronic
962380816 3:134897094-134897116 CAGAGTTAAGTCAGGGAACCTGG + Intronic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962661840 3:137609532-137609554 CAGTGTTAACTTTGGGAAGTAGG - Intergenic
965520592 3:169665447-169665469 CCATCTAAACTGAGGGAAGCTGG - Intergenic
969098705 4:4752961-4752983 CAGAGTTAACTGGGGGCAGGGGG - Intergenic
970067550 4:12116216-12116238 CACTGTGATCTCAGGGAAGCAGG + Intergenic
974245966 4:59318124-59318146 AAGTTTTTACTGAAGGAAGCTGG - Intergenic
974397482 4:61357555-61357577 CAGTGTAAACTAAAGAAAGCAGG - Intronic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
979790953 4:124780682-124780704 TAGTGTTGGCTGAGAGAAGCGGG - Intergenic
989758479 5:44984763-44984785 CAGTTTGCACTGAAGGAAGCAGG - Intergenic
990042265 5:51389326-51389348 AAGTGTTAGCCAAGGGAAGCAGG - Intronic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
996519939 5:124415152-124415174 CAGTGTTGACTGGGTGAGGCCGG + Intergenic
997178909 5:131807772-131807794 CAGTGTTAACTAGGTAAAGCTGG - Intronic
997365523 5:133322863-133322885 TGGGGTTGACTGAGGGAAGCTGG + Intronic
998683073 5:144492554-144492576 GAGTTTTATCTTAGGGAAGCAGG + Intergenic
999459402 5:151744977-151744999 CAGTGTGAAATGAGGAAAGTTGG + Intronic
999960957 5:156755214-156755236 ACGTGTTAACTGAGGGAAGAAGG + Intronic
1000574453 5:162959695-162959717 CATGGTTACCTGAGGAAAGCGGG + Intergenic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1004156707 6:13175564-13175586 CTCTGTTAACTGAGGTTAGCAGG + Intronic
1006512680 6:34530148-34530170 CAGAGTCCACTCAGGGAAGCAGG - Intronic
1006903984 6:37521032-37521054 TTCTGTTAACTGAGGAAAGCAGG - Intergenic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1011293682 6:85804940-85804962 CACTGTGAACTGAGAGAAGTAGG - Intergenic
1011411634 6:87072532-87072554 CATTTTTATGTGAGGGAAGCTGG - Intergenic
1011738634 6:90337270-90337292 CACTGATAACTGAGGGCAGGAGG - Intergenic
1013954950 6:115831128-115831150 CTGTGTCAACTGAGATAAGCTGG + Intergenic
1014633648 6:123817729-123817751 CAGTGGTAAATGAGGAGAGCAGG + Intronic
1016305365 6:142678504-142678526 CAGTGTTAGGTGAGGGCACCTGG + Intergenic
1016629520 6:146212092-146212114 ATGTATTAACTGAGGGAATCAGG + Intronic
1016801557 6:148174189-148174211 CTTTGGTAACTGATGGAAGCAGG - Intergenic
1018455832 6:163951475-163951497 CAGTGTTGAGTCAGAGAAGCTGG + Intergenic
1019321782 7:419313-419335 CAGGGGTGACTGAGGGGAGCTGG - Intergenic
1022632402 7:32097706-32097728 CAGTGTTGGCTGAGGCTAGCTGG - Intronic
1024634585 7:51276637-51276659 CAGTGTTTACTGCGGGCAGTGGG - Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1030106864 7:105994917-105994939 CAGTGCAACCTGAGGGCAGCTGG + Intronic
1034058082 7:148057664-148057686 AAGTTTTAACTGAGGGTAGGAGG - Intronic
1035032208 7:155868846-155868868 AAGTGATAACTGATGGAAGTAGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1036244148 8:7102304-7102326 CAGTGTTACCTCTGAGAAGCAGG - Intergenic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1039608161 8:38899993-38900015 CGGTGTTAACAGAGGAAAGGCGG - Intergenic
1041715342 8:60927073-60927095 CAGTCTTAATTTAGGGAAACAGG - Intergenic
1042016139 8:64314662-64314684 CTGTGATAACTGAGCTAAGCTGG - Intergenic
1042521671 8:69718924-69718946 CATTTTTAACTGAGGGATCCTGG + Intronic
1045471619 8:102517797-102517819 CAGGGTTCATTCAGGGAAGCAGG - Intergenic
1048351236 8:133618380-133618402 CTGTGTTGACTTAGGGAATCAGG + Intergenic
1051397091 9:16634843-16634865 CAGTGTACACTGAGGGGAGGGGG + Intronic
1052733410 9:32315981-32316003 CAATGTGAACTGAGGGAAAATGG - Intergenic
1053536276 9:38929548-38929570 CAGTGTTCACTGAGGGGATGGGG - Intergenic
1053655254 9:40212761-40212783 CAGAGTTAATTGAGCAAAGCAGG + Intergenic
1054367370 9:64358977-64358999 CAGAGTTAATTGAGCAAAGCAGG + Intergenic
1054529346 9:66163553-66163575 CAGAGTTAATTGAGCAAAGCAGG - Intergenic
1054629859 9:67434400-67434422 CAGTGTTCACTGAGGGGATGGGG + Intergenic
1054674999 9:67848714-67848736 CAGAGTTAATTGAGCAAAGCAGG + Intergenic
1054990112 9:71315485-71315507 CAGTGACAACTGAGTAAAGCAGG - Intronic
1055403664 9:75951084-75951106 TAGTATTAACTGATGGAAACAGG + Intronic
1056793826 9:89642868-89642890 CACAGTCTACTGAGGGAAGCAGG - Intergenic
1057941499 9:99289157-99289179 CAGTGTCAATTTAGTGAAGCTGG - Intergenic
1058736996 9:107902824-107902846 CAGTGGTAACTTAGGTAAGCTGG - Intergenic
1059139156 9:111835704-111835726 GAGAGTTAACTGATGGAATCAGG - Intergenic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1060485685 9:124045157-124045179 CAATTTTAAATGAGGAAAGCAGG + Intergenic
1185865564 X:3620767-3620789 CAGTGATAACTGAAGGGTGCAGG + Intronic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1187059176 X:15769555-15769577 AAGTGTAAAGTCAGGGAAGCAGG - Intronic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1192699841 X:73457219-73457241 CAGTGTTCACTTAGGGTAGTGGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197331897 X:125163004-125163026 CATTGGTAACTCTGGGAAGCTGG - Intergenic
1197401559 X:125998113-125998135 CAATTTTAACTGAGGCAAGAAGG + Intergenic
1198392539 X:136190819-136190841 AGCTGTTAACTCAGGGAAGCAGG + Intronic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1200121294 X:153792137-153792159 CAGTGATAACCTAGGGAAGGGGG - Intronic