ID: 1115444127

View in Genome Browser
Species Human (GRCh38)
Location 14:33469946-33469968
Sequence GCATCAGGGGGCCAGCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115444120_1115444127 5 Left 1115444120 14:33469918-33469940 CCTGGGTAGGTTTTCTCAGCTTC 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1115444127 14:33469946-33469968 GCATCAGGGGGCCAGCTCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115444127 Original CRISPR GCATCAGGGGGCCAGCTCAA GGG Intronic
900332953 1:2145352-2145374 GCATCAGGGGGCCATTCTAAGGG - Intronic
901078944 1:6572790-6572812 GCATCAGGGGCTCAGATCAGAGG - Intronic
907359029 1:53899964-53899986 GCTTCAGGAGGGCAGCTCAGAGG - Intronic
911216365 1:95199991-95200013 GAATCATGGGGTCAGCTCATTGG - Intronic
912419973 1:109536213-109536235 GCATCTGGGAGCCAGGCCAAGGG - Intergenic
912459040 1:109819060-109819082 GGACTAGGGGGCCAGCGCAAGGG - Intergenic
912469905 1:109899502-109899524 GCATCAGGGGCCAGACTCAATGG + Intergenic
912717455 1:111991857-111991879 GCATCTTGGGGGCAGCTCAGGGG + Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
917706575 1:177640837-177640859 GGGTCAGCAGGCCAGCTCAAAGG - Intergenic
919132761 1:193472200-193472222 TCATCACAGGGCCAGCTTAAAGG - Intergenic
921149299 1:212386846-212386868 GCATCAGGGCCCCAGATCTAGGG - Intronic
1065183055 10:23145989-23146011 GCATCCTGGGGTCAGCACAATGG - Intergenic
1067020152 10:42789255-42789277 GCAACACTGGACCAGCTCAAAGG - Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1071668957 10:87589321-87589343 GAATGAGGGGGCCACTTCAAAGG - Intergenic
1074176609 10:111011670-111011692 GCTGCAGAGTGCCAGCTCAAAGG - Exonic
1075389716 10:122083674-122083696 GCAGCAGGCGGCCAGCCCGAAGG + Exonic
1076843346 10:133057259-133057281 GCATCAGGTGACCAGCACAGGGG + Intergenic
1077170833 11:1165079-1165101 GCCTCAGGGGGCCAGGACAGGGG - Intronic
1077408320 11:2392380-2392402 GCATCATGGGGGCAGCACCATGG - Intronic
1078279330 11:9884155-9884177 GAATCATGGGTCCAGGTCAAAGG + Intronic
1078413056 11:11143383-11143405 GCATGCTGGGGCCAGGTCAAAGG - Intergenic
1080790043 11:35514445-35514467 GCAGCAGGGGGCAAGATAAATGG - Intronic
1081660019 11:44882321-44882343 GCCTCAGGGAGCCTCCTCAATGG - Intronic
1083899177 11:65635489-65635511 GGGTCAGGGGGCCGGCCCAAGGG - Intronic
1083949111 11:65944276-65944298 GAATCACGGGCCCAGCTCATAGG - Intergenic
1090493996 11:127192040-127192062 GCATCAGGGGCCTAGAGCAATGG - Intergenic
1092024684 12:5230833-5230855 GCTTCTGGGGGACATCTCAAAGG + Intergenic
1092261437 12:6955299-6955321 ACATCTGGGGGACAGCTCAGGGG - Intronic
1093195805 12:16128378-16128400 GCATCAGGGGACCAGAGCATGGG + Intergenic
1094202896 12:27811256-27811278 CCATCATGGTGCCTGCTCAAAGG + Intergenic
1094838661 12:34333971-34333993 CCAGCGGGGGGCCAGCCCAAAGG + Intergenic
1098184166 12:67878718-67878740 GACTCAGGTGGCCACCTCAAGGG - Intergenic
1100130146 12:91482397-91482419 GCAACAGGAGCCCAGCTCAGGGG - Intergenic
1114253833 14:20984982-20985004 GCATGAGGGGGCCAGGGCCAGGG - Intergenic
1115444127 14:33469946-33469968 GCATCAGGGGGCCAGCTCAAGGG + Intronic
1126776881 15:52107906-52107928 CCTTCAGGGGCCCAGCTCAGTGG - Intergenic
1127375304 15:58378876-58378898 CCATGAAGGCGCCAGCTCAATGG + Intronic
1128080963 15:64856723-64856745 GCATCCTGGTTCCAGCTCAAGGG + Intronic
1134640101 16:15823217-15823239 GCTGCACGGGGCCAGCTCCAGGG - Intronic
1147645598 17:42031854-42031876 CCAGCAGGGGGACAGGTCAAAGG + Intronic
1148560892 17:48605478-48605500 GAATGAGGGGGCCAGTTCAGAGG - Intergenic
1151930803 17:77230351-77230373 GCATCCGGGGGCCTGGTCCACGG - Intergenic
1152285399 17:79409806-79409828 GCGGCAGGGGGCCAGCTCTAGGG + Intronic
1153237305 18:3000390-3000412 CCACCAGGTGCCCAGCTCAAAGG + Intronic
1153953769 18:10078713-10078735 GCTTCAGGGGGCCTGAGCAAGGG + Intergenic
1157325940 18:46668944-46668966 GCAGCAGGGGGCCAGCACCATGG + Intronic
1158307788 18:56125592-56125614 GTATCAGAGAGCCAGCTCAGTGG + Intergenic
1160473975 18:79166426-79166448 GCATCATTTGGCCAGCTCAGAGG - Intronic
1160933337 19:1581064-1581086 GCAGCAGGGGACCAGGCCAAGGG + Intronic
1162920555 19:13899638-13899660 CCATCAGGTGCCCACCTCAAAGG + Intronic
1163171060 19:15531455-15531477 GCATCTGGGGACCATCTCCAGGG + Intronic
925873105 2:8287688-8287710 GAAGCAAGGGGGCAGCTCAAAGG + Intergenic
928168422 2:28987852-28987874 GCATGTGGGGGCCAGCAGAAAGG - Intronic
930395753 2:50821850-50821872 GCATCACTGGGCCAGGACAAAGG + Intronic
931192701 2:60021005-60021027 GCATCAGGTGGGCAGCTGAGAGG + Intergenic
937269808 2:120642021-120642043 CCATCAGGGCCCCAGCACAATGG - Intergenic
938079615 2:128362806-128362828 GCCTCAGTGGGGCAGCTCCAAGG - Intergenic
940862760 2:158787510-158787532 ACTTCAGAGGGACAGCTCAAAGG - Intergenic
1169421841 20:5466672-5466694 GCATCTGGAGGCCAGCTGGAAGG - Intergenic
1171995587 20:31728369-31728391 GCATCAGGAATCCAGCTTAATGG - Intergenic
1175444187 20:59008819-59008841 GCATCAGAGGCCAAGCACAAGGG - Intergenic
1176168604 20:63687152-63687174 GAACAAGGGCGCCAGCTCAAAGG - Intronic
1176256834 20:64157343-64157365 TGCTCAGGGGGCCAGCTCCAGGG - Intronic
1178016897 21:28357336-28357358 ACATCAGTGAGCCAGCTCCATGG - Intergenic
1180154955 21:45973222-45973244 GCCTCCGGGGCCCAGCTCTAGGG + Intergenic
1182630501 22:31681658-31681680 GCACTAGATGGCCAGCTCAACGG + Exonic
1182636841 22:31734701-31734723 GCATCTGGAGGCCAGGTCATTGG - Intronic
1182947042 22:34333641-34333663 TCTGCAGGGGGCCACCTCAAGGG - Intergenic
1183786554 22:40032269-40032291 GCACCAGGGGCTCAGCTCACTGG - Exonic
1184385511 22:44172156-44172178 GCAGCAAGGGGCCAGTTCCAAGG + Intronic
952145885 3:30531440-30531462 CCCTCAGGGGGCCAGCTCAGGGG + Intergenic
953884163 3:46706201-46706223 GCATCAGGAGGCCAGCCATAGGG - Intronic
954410402 3:50368074-50368096 GCAGCATGGGGCCAGCCCAGAGG - Intronic
956467807 3:69536268-69536290 CCATCAGGGGGCCATCTCCCTGG + Intronic
956614639 3:71158422-71158444 GCCTCAGAGGGACAGCTCAGGGG - Intronic
961572688 3:127811593-127811615 ACATCAGGAGGCCAGCCCAGAGG - Intronic
963451694 3:145490333-145490355 ACTTCAGGGGGACAGCTTAATGG + Intergenic
968431391 4:561159-561181 GCAGCAAGGGGGCAGCTCCAGGG + Intergenic
969179013 4:5423193-5423215 GCATTAGGGGTCAGGCTCAAGGG + Intronic
970366543 4:15364768-15364790 GCATCAGTGGGCAAGCACATGGG + Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
973140466 4:46761277-46761299 GTAGCAGGGGGCCACCTAAATGG + Intronic
982304290 4:153913709-153913731 AAATCAGGGGTGCAGCTCAATGG + Intergenic
986299275 5:6465771-6465793 GCTTCCGGAGGCCAGCTCCAGGG + Intronic
992204387 5:74416350-74416372 GCATCAGGTGCCCAGGTCTAGGG + Intergenic
999539512 5:152556324-152556346 GCATCAGGGAGCCAGGTACAAGG + Intergenic
1002445017 5:179285356-179285378 GCCTCACGGGGCCAGCGCAGGGG + Intronic
1002861797 6:1085975-1085997 GCACCTTGGGGCCAGCTCCATGG - Intergenic
1003892214 6:10573741-10573763 GCACCAGCAGGCCAGCTCACTGG + Intronic
1006140632 6:31927537-31927559 GCATCAGGGAGACAGGGCAAAGG + Exonic
1006607561 6:35269452-35269474 TCACCAGAGGGCCAGCTCTAAGG - Intronic
1007483058 6:42162718-42162740 GCAGCAGGGGGCCAGGTCAGGGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1010807702 6:80258547-80258569 GGATCAGGGGAGCAGCCCAAGGG + Intronic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1028954857 7:96677113-96677135 TCAGCAGAGGGCCAGCACAATGG + Intronic
1034563131 7:151894465-151894487 GCAGCAGGGGGCCCGGACAAAGG - Intergenic
1036685168 8:10904665-10904687 GCATCAGGGGGCCAGCATATGGG + Intronic
1041402177 8:57457488-57457510 GCAACAGGGAGCCAGTTCCAGGG + Intergenic
1043116072 8:76255249-76255271 CCATCAGGGGGCCAGAGGAAAGG + Intergenic
1045789440 8:105965077-105965099 GGAACAGGGCACCAGCTCAAAGG - Intergenic
1048146618 8:131851233-131851255 GCATCAGGGGGGTGGATCAATGG - Intergenic
1051367107 9:16329033-16329055 GAATCAGGAGGCCAGCTCTGTGG - Intergenic
1053004454 9:34594685-34594707 GCATAAGGGGACCAGCACTAGGG - Intergenic
1060515241 9:124261505-124261527 ACATCAGGGGGCCAGAACACCGG - Intronic
1060521201 9:124295053-124295075 GCATCAGGAGGCCAGCTGATTGG - Intronic
1061387225 9:130297464-130297486 CCATCTGGTGGCCAGATCAAAGG + Intronic
1061443519 9:130623788-130623810 GCCTCAGGGTGACAGCTCTATGG - Intronic
1061909860 9:133716769-133716791 GCACCTGGAGGCCAGCTCAGCGG - Intronic
1062600925 9:137318296-137318318 GCAGCCGGGGCCCAGCTCATGGG - Intronic
1185468626 X:369780-369802 GCAGCAGGGGGCCGGCGGAAGGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1193291372 X:79777117-79777139 GCAGCAGGGTGGCAGCTCAACGG + Intergenic
1195029064 X:100908873-100908895 GCATGAAGGGGCTAGCTGAAAGG + Intergenic
1195986377 X:110635208-110635230 ACCTCAGGGGGCCAGCTCAGAGG + Intergenic
1198011022 X:132554326-132554348 ACAGCAGGGAGCCAGTTCAAGGG + Intergenic
1199978490 X:152908054-152908076 GCATCTGTGGGCCTGCTCACTGG - Intergenic
1200776981 Y:7178134-7178156 GCATCCGTGGGCTAGCACAAAGG - Intergenic