ID: 1115444468

View in Genome Browser
Species Human (GRCh38)
Location 14:33473333-33473355
Sequence TTGCATGTGAATCATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115444468_1115444471 -2 Left 1115444468 14:33473333-33473355 CCCTCCACATGATTCACATGCAA 0: 1
1: 0
2: 1
3: 21
4: 257
Right 1115444471 14:33473354-33473376 AAGTCCTAGTTAAAAGATGCTGG 0: 1
1: 1
2: 0
3: 10
4: 129
1115444468_1115444472 1 Left 1115444468 14:33473333-33473355 CCCTCCACATGATTCACATGCAA 0: 1
1: 0
2: 1
3: 21
4: 257
Right 1115444472 14:33473357-33473379 TCCTAGTTAAAAGATGCTGGAGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115444468 Original CRISPR TTGCATGTGAATCATGTGGA GGG (reversed) Intronic
900948160 1:5842974-5842996 TTCCCTGCGAATCAGGTGGAGGG - Intergenic
901198859 1:7455540-7455562 TTGCTTATGAAGCAGGTGGAGGG - Intronic
905496856 1:38396719-38396741 TTGCATGTCATTCTTGTGCAGGG - Intergenic
905648831 1:39643079-39643101 TGGGATGTGAAGCGTGTGGATGG - Intergenic
905807865 1:40889980-40890002 GTGCATCAGAATCATCTGGAGGG + Intergenic
907009391 1:50949260-50949282 TTGCATCAGAATAATTTGGAGGG - Intronic
907652484 1:56309087-56309109 TTTCATGTCAATCATGTTCATGG - Intergenic
907743981 1:57194127-57194149 GTGCATTAGAATCATCTGGAGGG + Intronic
907816082 1:57919425-57919447 GTGCTTGTGAAACATGTGAAAGG + Intronic
908046331 1:60173497-60173519 ATGCATCAGAATCATGTTGAGGG + Intergenic
911006112 1:93226381-93226403 TTGCATTTGAATCAATTGGAAGG + Exonic
911371548 1:97000691-97000713 CTGCATGTGAATTATCTGTAGGG + Intergenic
917186846 1:172366600-172366622 TTGCATGTCATTCTTGTGCAGGG - Intronic
917200261 1:172507191-172507213 TTGCATGTGACATATGAGGATGG - Intergenic
917243146 1:172971353-172971375 TGGCATGTAAAGTATGTGGAGGG - Intergenic
918858608 1:189792116-189792138 TTGCACATGAATAATGTTGATGG + Intergenic
919321888 1:196052775-196052797 TTTCAAGTGAATCATGTGTATGG - Intergenic
920095817 1:203485989-203486011 TTGGATGTGAGACATGAGGATGG - Intronic
920213047 1:204342524-204342546 GTGCATATGAATCACCTGGAGGG + Intronic
921324431 1:213977240-213977262 CTGAATGTGAATTATGGGGAGGG - Intergenic
922224821 1:223637173-223637195 TGGCATCTGTATCATTTGGAGGG - Intronic
924030956 1:239885261-239885283 GTGCATCTGAATCACCTGGAAGG + Intronic
924154919 1:241166028-241166050 TTGCATCGGAATCACCTGGAGGG - Intronic
1063532150 10:6843864-6843886 TTGCATGTTATTCATCTGCATGG + Intergenic
1067008815 10:42691079-42691101 TTCCATGGGAATCATGGGCATGG - Intergenic
1067926416 10:50513005-50513027 TTACAAGTGAAACTTGTGGAAGG - Intronic
1069860349 10:71467311-71467333 GTGCATGAGAATCCTCTGGAAGG + Intronic
1072313905 10:94183453-94183475 TGGTATGTGAATGGTGTGGAGGG - Intronic
1073054092 10:100688107-100688129 TGGCTAGTGAATCAAGTGGAGGG - Intergenic
1075101055 10:119506553-119506575 TGGAATTTGAATCGTGTGGACGG - Intronic
1077053975 11:581199-581221 GTAAATGTGAATCATGTGTAAGG + Intronic
1077903365 11:6508953-6508975 TTGCATGTACATCCTGTGGAAGG + Exonic
1078927226 11:15885882-15885904 GTGCATGGGAATCATCTGGGGGG - Intergenic
1079442663 11:20531017-20531039 GTGCATCTGAATCATGTTGTGGG + Intergenic
1079509513 11:21194718-21194740 ATGCATGAGCATCATATGGAAGG - Intronic
1085310748 11:75515277-75515299 TTGCATGGAAACCATGTGGGAGG - Intronic
1086862491 11:91941377-91941399 TTGCTTGTGAATGAAGGGGAAGG - Intergenic
1086924387 11:92624556-92624578 TTGCTAGTGATCCATGTGGAAGG + Intronic
1089468199 11:118699540-118699562 GCGCATGTGAAAAATGTGGATGG - Intergenic
1089947373 11:122490869-122490891 GTGCATAAGAATCATCTGGAGGG + Intergenic
1090489489 11:127145822-127145844 ATGCATGAGAATTATCTGGAGGG + Intergenic
1090831184 11:130421909-130421931 CTGCATGTGAAGAATGTGAACGG + Intronic
1091485933 12:888432-888454 TAGCAAGTGAGACATGTGGAGGG + Intronic
1093585508 12:20830673-20830695 TTGCAAGTGAATTCTGTGAAAGG - Intronic
1094153912 12:27317194-27317216 TTGCATGTTTATCATGTGCAAGG - Intronic
1094535842 12:31322780-31322802 CTGCATTTGAATCATGTGTAAGG - Intronic
1094837565 12:34329282-34329304 TTGCATGTTGCCCATGTGGAAGG - Intergenic
1095263122 12:40121235-40121257 TTGCATGTTAATCTTTTGTAAGG + Intergenic
1097156193 12:57013943-57013965 ATGCATGTGAATCACCTGGGGGG - Intronic
1097602026 12:61704844-61704866 TTGCATAAGAATCATGTTGATGG - Intergenic
1099470976 12:83047495-83047517 TGGAATGTGAATCATCTGGCTGG - Intronic
1099643783 12:85324591-85324613 TTGCCTGTGAACCATTTTGAAGG + Intergenic
1100167478 12:91932759-91932781 TGACATGTGAAAAATGTGGATGG - Intergenic
1100393131 12:94161554-94161576 ATGCATTTGAATCATGGGAAAGG + Intronic
1100783927 12:98059106-98059128 TTGGATGTCAATCATTTTGAAGG - Intergenic
1100905803 12:99297728-99297750 TTGCCTGTGAGTCACTTGGAAGG - Intronic
1102065382 12:109970717-109970739 TTGCAGAAGAATAATGTGGAAGG - Intronic
1103646801 12:122400199-122400221 ATGAATGTGAATGAAGTGGAAGG - Intronic
1104559227 12:129828919-129828941 TTGCCTGTGAAAGAGGTGGAAGG + Intronic
1104641159 12:130468309-130468331 TGGCATGAGAAACATCTGGAAGG + Intronic
1105420898 13:20251474-20251496 GTGCATCAGAATCATCTGGAGGG + Intergenic
1107891901 13:44921342-44921364 TGGCATCAGAATCATTTGGAGGG - Intergenic
1108464707 13:50703697-50703719 TGGCATGTGATTCATATGAAAGG - Intronic
1108535373 13:51371155-51371177 ATGCATGTGAATCACCTGGGAGG - Intronic
1108695874 13:52901881-52901903 GTGCGTGGGAATTATGTGGAGGG - Intergenic
1110181308 13:72620670-72620692 TTGCTTGTGAATTGTGTAGAGGG + Intergenic
1110329823 13:74258669-74258691 TTGGATGTGTATGATGGGGATGG + Intergenic
1111658143 13:91177100-91177122 GTGCATCAGAATCATCTGGAGGG - Intergenic
1111831119 13:93330840-93330862 TTGCATGTCAATCATTTTGTTGG - Intronic
1112850573 13:103701072-103701094 CTGCAGGTGAATCACGTGGCTGG - Intergenic
1115023219 14:28708418-28708440 TTGCAGAAGAAGCATGTGGATGG + Intergenic
1115210630 14:30964512-30964534 ATGCATGTGGATCAGGTGAAGGG - Intronic
1115444468 14:33473333-33473355 TTGCATGTGAATCATGTGGAGGG - Intronic
1115884850 14:37959642-37959664 TTACATGTAGATCATGTGCATGG + Intronic
1116205392 14:41858907-41858929 TTGTATGGGAACCATTTGGAAGG - Intronic
1117093909 14:52277801-52277823 ATGCATGAGAATCACCTGGAGGG - Intergenic
1117500475 14:56346180-56346202 TTGCATCAGAATCACCTGGAGGG - Intergenic
1117689754 14:58294469-58294491 TTGGTTGTGCAACATGTGGAAGG + Intronic
1117812862 14:59567049-59567071 TTGCATCAGAATCATCTGGAGGG - Intronic
1118426516 14:65669866-65669888 ATGCATGAGAATCATCTGGAAGG + Intronic
1120010073 14:79403720-79403742 TTGCATGTGAGTGATGGTGAGGG + Intronic
1121843963 14:97157004-97157026 TTGTGTGTGAATCATGGGGAAGG + Intergenic
1122166445 14:99827955-99827977 TTGCCTGTGAATGAAATGGAGGG + Intronic
1202929499 14_KI270725v1_random:25846-25868 TTGCATGGGAATCCTGAGCATGG + Intergenic
1123422799 15:20145377-20145399 TTGCATGGGAATCCTGAGCATGG - Intergenic
1123532024 15:21151917-21151939 TTGCATGGGAATCCTGAGCATGG - Intergenic
1124094291 15:26634251-26634273 TTGCATGTGGGGCATCTGGATGG - Intronic
1124367269 15:29081019-29081041 CTCCGTGTGGATCATGTGGAAGG + Intronic
1126168340 15:45672895-45672917 GTGCATCTGAATCAGCTGGAGGG + Intronic
1129072781 15:72964882-72964904 TTGGATGTGAAATTTGTGGAGGG + Intergenic
1130624414 15:85498905-85498927 GTGCATCAGAATCATGTGAAGGG - Intronic
1131432427 15:92397211-92397233 TTACATGTGTATTATCTGGAGGG + Intronic
1131523087 15:93131292-93131314 ATGCATCAGAATCATTTGGAGGG - Intergenic
1135615283 16:23906071-23906093 TCGCATTGGAATCATGAGGACGG + Intronic
1136044093 16:27601931-27601953 TTGGATGGAAATCAGGTGGATGG + Intronic
1137759023 16:50925641-50925663 TAGCATGAGCACCATGTGGACGG - Intergenic
1138500829 16:57442966-57442988 TTGCAGTTGGATCATATGGAAGG - Intronic
1140503228 16:75452739-75452761 TTGCAAGTAAATGATGTTGAAGG - Intronic
1140628424 16:76822591-76822613 TTCCATCTGAATCACCTGGAAGG + Intergenic
1142816628 17:2431248-2431270 TTTCGTGTAAATCATGTGTATGG + Intronic
1143710074 17:8728328-8728350 ACGCATCAGAATCATGTGGAGGG + Intergenic
1143849169 17:9796695-9796717 TTCAATTTGAATCACGTGGACGG - Intronic
1144206942 17:12986151-12986173 TTGGATGTGATTAATGTTGAAGG + Intronic
1145065439 17:19758431-19758453 TTGTATGTGATTTTTGTGGATGG - Intergenic
1145509190 17:24093774-24093796 CTGCAAGTGGATCATTTGGAGGG + Intergenic
1146078325 17:29754276-29754298 TTGCATCAGAATCACCTGGAGGG - Intronic
1146136657 17:30327845-30327867 CTGCATGAGAATGGTGTGGATGG - Intronic
1146776444 17:35622057-35622079 TTGCATGTGAAGCACATGGAAGG + Intronic
1149400966 17:56295510-56295532 GTGCATTGGAATCATCTGGAGGG - Intronic
1149501066 17:57152856-57152878 TTGCATTAGAATCACCTGGAGGG - Intergenic
1149954487 17:61033221-61033243 ATGCATCAGAATCATCTGGAGGG + Intronic
1150326908 17:64264567-64264589 TTGCATTAGAATCACCTGGAGGG - Intergenic
1151457391 17:74234090-74234112 TTGCATCAGAATCACCTGGAAGG + Intronic
1153352613 18:4097580-4097602 TTGCATGAAAAGCATGTGGCTGG - Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1155545924 18:26914943-26914965 TTGGATGGGAAACATTTGGATGG - Exonic
1155918254 18:31577306-31577328 TAGCATCAGAATCATCTGGAGGG + Intergenic
1156132811 18:33998875-33998897 ATGTAAGTGAAGCATGTGGAAGG - Intronic
1158200517 18:54933743-54933765 CTGCATGTGTATTATGTGGAAGG - Intronic
1158442187 18:57486156-57486178 TTGCAAGTGAAGCATGAGGCTGG - Exonic
1159269896 18:66135010-66135032 TGGCATAAGAATCATCTGGAAGG + Intergenic
1159610262 18:70517088-70517110 TTACATGTGAATAATTTGGATGG + Intergenic
1161652304 19:5492822-5492844 TTGCAGGCGAAGAATGTGGACGG - Intergenic
1162674220 19:12286307-12286329 ATGCATGAGAATCATCTGAAGGG + Intronic
1164853988 19:31506401-31506423 TTTCATGTGAGTTATGTGGATGG + Intergenic
925538925 2:4945337-4945359 TTGCATGTCATCCATGTGCAGGG - Intergenic
926767129 2:16331207-16331229 TTGCATCTGCATCCTGTGGCAGG - Intergenic
927143007 2:20142430-20142452 ATGCATCAGAATCATCTGGAGGG - Intergenic
927306646 2:21581304-21581326 TTGAATGTCAATCATGTGCCAGG + Intergenic
929267843 2:39939045-39939067 GTGCATAAGAATCATCTGGAGGG + Intergenic
929884471 2:45866214-45866236 TTACATGTGAATCATCTGGAAGG + Intronic
930148134 2:48028737-48028759 TTGCATCAAAATCATCTGGAGGG + Intergenic
930466929 2:51765859-51765881 GTGTATGTGAATCATATGGCAGG - Intergenic
930864943 2:56113297-56113319 ATGCATCTGAATCACCTGGAGGG - Intergenic
931038486 2:58269393-58269415 TTTGATTTGAATCATATGGATGG + Intergenic
934460392 2:94211406-94211428 TTGCATGGGAATCCTGAGCATGG + Intergenic
935944913 2:108277010-108277032 AAGCATGTGGATCATGTGGATGG + Intergenic
937170823 2:119866431-119866453 TTGCATGAGAAACAACTGGAAGG + Intronic
941500805 2:166273476-166273498 TTGCATGTGAATCAGGTTCAAGG - Intronic
941552092 2:166929180-166929202 ATGCATTAGAATCATCTGGAGGG - Intronic
942778909 2:179617547-179617569 GTGCATGAGAATCACCTGGAAGG + Intronic
943609989 2:190020843-190020865 TTGCATGTTATTCATATGCATGG + Intronic
944131333 2:196350470-196350492 TTGCATCTGAATCATCTGGTTGG - Intronic
946333870 2:219024966-219024988 CTGCATGAGAATCATCTAGAAGG - Intronic
946814429 2:223562257-223562279 TTGCCTGAGATTCATGTTGAGGG - Intergenic
1169754859 20:9032983-9033005 ATGCATGAGACTCATCTGGAAGG - Intergenic
1169972805 20:11287933-11287955 GTGTATGAGAATCATCTGGAAGG - Intergenic
1172108829 20:32533407-32533429 TTGCATCAGAATCATCTGGGGGG - Intronic
1172459329 20:35104152-35104174 TTGCATTAGAATCACCTGGAGGG + Intergenic
1173454909 20:43194142-43194164 ATGCATGAGAATCACCTGGAAGG - Intergenic
1173460078 20:43236135-43236157 TTGCATCAGAATCATCTGGAAGG + Intergenic
1174527091 20:51181463-51181485 TTGCAGGGGAAGGATGTGGAGGG - Intergenic
1176591525 21:8654445-8654467 TTGCATGGGAATCCTGAGCATGG + Intergenic
1177882727 21:26713767-26713789 TTGGAAGTGCCTCATGTGGATGG - Intergenic
1178220052 21:30645782-30645804 TCCCATGGCAATCATGTGGATGG - Intergenic
1179207200 21:39292574-39292596 GTGCATGAGAATCACCTGGAGGG - Intronic
1180274372 22:10631557-10631579 TTGCATGGGAATCCTGAGCATGG + Intergenic
1182382108 22:29899611-29899633 TTGCATGTCATTCTTGTGCAGGG + Intronic
1184608514 22:45587857-45587879 CTGCATGTGGAGCGTGTGGACGG - Intronic
949856830 3:8469670-8469692 ATGTATCAGAATCATGTGGAGGG - Intergenic
950845132 3:16008017-16008039 TTGCATTAGGATGATGTGGAGGG + Intergenic
951113034 3:18828254-18828276 TTGCACTAAAATCATGTGGATGG - Intergenic
955408189 3:58639161-58639183 TTGCTTCTGAGTCATCTGGACGG + Intronic
955943358 3:64167786-64167808 TTGCATCAGAATCACCTGGAAGG + Intronic
956017685 3:64901127-64901149 TTTCATGTGAATCATGTCATTGG - Intergenic
958033226 3:88139384-88139406 TTGCATGTGTAATATGTGGTAGG + Exonic
958748659 3:98168002-98168024 ATGCATTTGAATCACCTGGAGGG + Intergenic
958752348 3:98206720-98206742 ATGCATTTGAATCAACTGGAGGG + Intergenic
959100067 3:102000329-102000351 TTTCATGTGCATGATTTGGAAGG + Intergenic
960399672 3:117180720-117180742 TTGCCTCTGAAACATCTGGATGG + Intergenic
960457458 3:117890430-117890452 TTACATTAGAATCATCTGGAAGG + Intergenic
961960139 3:130845996-130846018 ATACATTTGAATCATCTGGAGGG - Intergenic
962494631 3:135926819-135926841 TTGCATGTCAGGCAGGTGGATGG - Intergenic
962757577 3:138477957-138477979 CTGCATGTGAATCAGATGGCAGG - Exonic
963633763 3:147767653-147767675 ATGAATGTGGACCATGTGGAAGG - Intergenic
963898522 3:150711474-150711496 ATGCATCAGAATTATGTGGAAGG + Intergenic
963974226 3:151462387-151462409 CTGCATCAGAATCATATGGAAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965332518 3:167393868-167393890 TAAAATGTGAAACATGTGGAAGG - Intergenic
966136472 3:176704968-176704990 TTGCATCAGAATCACATGGAGGG - Intergenic
968149502 3:196325858-196325880 GTGCATGAGAATCACCTGGAGGG - Intronic
968957038 4:3724786-3724808 TTACATGTGATTTATGAGGATGG + Intergenic
972388895 4:38593921-38593943 ATGAATCAGAATCATGTGGAGGG - Intergenic
972779928 4:42278556-42278578 TTGCATTTAAATAATGGGGAGGG + Intergenic
974033270 4:56795294-56795316 TTGCAGCCGAATCATCTGGAGGG - Intergenic
975133157 4:70848160-70848182 TTGCATGTCATCCTTGTGGAGGG + Intergenic
976479984 4:85530896-85530918 TTGCATTTGCATAATGTGCAGGG + Intronic
976972474 4:91122502-91122524 TTGCGGGAGAATCATGTTGAAGG - Intronic
977664751 4:99633043-99633065 TTGCATGAGAAGCACCTGGAGGG + Intergenic
978763892 4:112384671-112384693 TAGCATCAGAATCATCTGGAGGG - Intronic
979742203 4:124165929-124165951 TTGCATGTGAAACTTGCTGAAGG + Intergenic
981296110 4:143133751-143133773 TTGGATGAGTATTATGTGGATGG - Intergenic
981977284 4:150746280-150746302 CTTCAAGTGACTCATGTGGATGG + Intronic
985067215 4:186134358-186134380 CTGCATGTGAAGCATGTTCATGG + Intronic
986082775 5:4411384-4411406 TTGGATTTGAATCAGGTAGAGGG + Intergenic
988042425 5:25906882-25906904 TTACATGTGAGAAATGTGGAAGG + Intergenic
988130847 5:27104053-27104075 TTAAATGTGAATGATGTGAATGG - Intronic
988437508 5:31193683-31193705 TTGCAAGTGAATGAAGTGGGAGG - Intergenic
989501073 5:42168678-42168700 TTACATGTGTATAATGTAGATGG + Intergenic
990431452 5:55738554-55738576 TTGGATGTTAATCATGCGAAGGG + Intronic
990801652 5:59610986-59611008 TTGTATGTGAATCCTCTGTAAGG - Intronic
993027277 5:82661350-82661372 TTGCATATGAACCATGTTCAAGG + Intergenic
994069195 5:95579504-95579526 TTGTAATTGAATCATGGGGATGG - Intronic
994374247 5:99000691-99000713 TTGCAGGTAAAATATGTGGAAGG + Intergenic
995437269 5:112150966-112150988 TTGCATATGAATCACCTGGGGGG + Intronic
995774341 5:115709631-115709653 TTGCCTAAGAATCATCTGGAAGG - Intergenic
999345342 5:150813500-150813522 AGGCATGTGAATCATGAGGCCGG - Intergenic
1000161407 5:158601159-158601181 TTGCATTAGAATCACCTGGAGGG + Intergenic
1001370768 5:171198543-171198565 AGGCATCTGAATCATCTGGAGGG + Intronic
1003243849 6:4367897-4367919 ATGCATCAGAATCATCTGGAAGG + Intergenic
1004058981 6:12171928-12171950 TCGCTTGAGAATCAAGTGGAGGG - Intergenic
1004845952 6:19642451-19642473 TTGCATGTCATTCTTGTGCAGGG + Intergenic
1005065641 6:21815065-21815087 TTGCATGAGAAAGATGTGAATGG - Intergenic
1005884665 6:30087783-30087805 TTGAATGTAAATAATGTGAAGGG - Intergenic
1006357969 6:33571930-33571952 TTGCATGTGACCCTTTTGGAAGG + Intergenic
1007998136 6:46330324-46330346 TTGCATCAGAATCACCTGGAGGG - Intronic
1008019934 6:46565033-46565055 GTGCATCAGAATCATCTGGAGGG + Intronic
1008420259 6:51291016-51291038 CTTTATGTGAATTATGTGGAGGG + Intergenic
1009374761 6:62953503-62953525 TTCCAAGTAAATCATCTGGAAGG - Intergenic
1010388727 6:75312291-75312313 TAGCATGAGAAGCATGTGGCTGG + Intronic
1011560065 6:88605151-88605173 TTTATTGTGAATGATGTGGAAGG + Intergenic
1013053902 6:106564529-106564551 TTGCATCAGAATCACCTGGAGGG + Intronic
1013327288 6:109059533-109059555 TTGCATGTCATTCTTGTGCAGGG + Intronic
1013865023 6:114685821-114685843 TGGCCTGTGAATCAAGTAGAAGG + Intergenic
1013969805 6:116003091-116003113 TTAGATGTGAACCTTGTGGAGGG - Intronic
1015328759 6:131953055-131953077 TTGCATGTCAATAGTGTGAATGG + Intergenic
1018116112 6:160587087-160587109 ATGAATGTAGATCATGTGGATGG - Intronic
1018398157 6:163396983-163397005 CTGCATGTGAATCAGGGGGGTGG + Intergenic
1021507253 7:21399246-21399268 TTGCATTAGAATCACCTGGAGGG - Intergenic
1022767868 7:33435486-33435508 TTGTATGTAAAATATGTGGAAGG + Intronic
1023293337 7:38689819-38689841 ATGCATCTGAATCACCTGGAGGG - Intergenic
1023364118 7:39446035-39446057 TTGCATCAGAATCACCTGGAGGG - Intronic
1024293155 7:47820990-47821012 TGGGATGTGAAACATGGGGAAGG + Intronic
1025612303 7:63086064-63086086 TTGCAAGTGATTCATGAGGTAGG - Intergenic
1027836256 7:83247886-83247908 ATGAATCTGAATGATGTGGAAGG - Intergenic
1028311040 7:89336295-89336317 ATGCATATAAATCATGTAGAGGG + Exonic
1028361626 7:89974369-89974391 TTGCATTTCAATCACTTGGAGGG - Intergenic
1028680948 7:93530989-93531011 TTACATGGGAATCATCTGGAAGG - Intronic
1030129056 7:106181112-106181134 TTGCATCAGAATCATCTCGAGGG - Intergenic
1031028506 7:116709040-116709062 TCTCATGAGAATCATGTGCATGG + Intronic
1031337501 7:120554310-120554332 TTGCATCAGAATCACCTGGAGGG + Intronic
1033254023 7:139783970-139783992 ATGCATGTGAAGGATGTGAAGGG - Intronic
1036438546 8:8758960-8758982 ATGCATCAGAATCATCTGGAGGG - Intergenic
1043671513 8:82891075-82891097 TTGTAGGTGAATTATGTGAATGG + Intergenic
1046279681 8:112009582-112009604 TTTCATGATAATCATATGGATGG + Intergenic
1046680699 8:117166468-117166490 TGGCATCAGAATCACGTGGAGGG + Intronic
1046803625 8:118455906-118455928 TTGCCTTTGAATGAGGTGGAAGG - Intronic
1047180940 8:122587156-122587178 TTTCATGTGGAACATGTGGTAGG - Intergenic
1047334179 8:123920257-123920279 TTGCAAGACAATCAAGTGGATGG + Intronic
1048007465 8:130431136-130431158 TGGCATGGGGATCATTTGGAGGG - Intronic
1050529444 9:6575516-6575538 GTGCATGAGAATCACCTGGAGGG - Intronic
1051044965 9:12861926-12861948 TTGCATGAGAATCACCTGGAGGG + Intergenic
1053690891 9:40587103-40587125 TTGCATGGGAATCCTGAGCATGG + Intergenic
1054273912 9:63050388-63050410 TTGCATGGGAATCCTGAGCATGG - Intergenic
1054302150 9:63388074-63388096 TTGCATGGGAATCCTGAGCATGG + Intergenic
1054400928 9:64714580-64714602 TTGCATGGGAATCCTGAGCATGG + Intergenic
1054434534 9:65198894-65198916 TTGCATGGGAATCCTGAGCATGG + Intergenic
1054495856 9:65822787-65822809 TTGCATGGGAATCCTGAGCATGG - Intergenic
1054776737 9:69130414-69130436 TTGCATCTGAACCATCTGGAAGG + Intronic
1054937792 9:70707379-70707401 TTGAATGTGAATGCTGTGCATGG - Intronic
1054939483 9:70725372-70725394 TTGAATGTGAATGCTGTGCATGG - Intronic
1055491112 9:76806240-76806262 TTGCATAGGAGTCATCTGGAGGG - Intronic
1056509717 9:87292191-87292213 TTGCCTGAGAATAAGGTGGAAGG - Intergenic
1058633117 9:107009596-107009618 TTCCATGTGAATTTTGTGGACGG + Exonic
1058682886 9:107455576-107455598 TTGCATGTAAATCATGTATGGGG - Intergenic
1059010751 9:110456311-110456333 GTGCATCAGAATCATCTGGAAGG - Intronic
1059859317 9:118440585-118440607 TTGCATGTTAATTTTTTGGAAGG - Intergenic
1060558434 9:124522476-124522498 AAGCATGTGCATCATGTTGAAGG + Exonic
1062026461 9:134342879-134342901 TTGTATGTGAGTGATGTGGGTGG + Intronic
1203621550 Un_KI270749v1:133209-133231 TTGCATGGGAATCCTGAGCATGG + Intergenic
1186765607 X:12767823-12767845 TTTAATGTGAGTCATTTGGAGGG + Intergenic
1188215501 X:27471561-27471583 TGGAATGTGAACCATGAGGAAGG - Intergenic
1188875813 X:35428900-35428922 TTGCCTGTGAGTCATTTGGGAGG + Intergenic
1190033848 X:47001229-47001251 GTGCATCAGAATCATTTGGAGGG + Intronic
1190915869 X:54810815-54810837 ATGCAGGTGAAGCATCTGGATGG + Exonic
1191030291 X:55962232-55962254 CTGCATGTTAATGATGTGGTTGG - Intergenic
1194715188 X:97279757-97279779 TAGCATGTGAAGAATGTGGCTGG + Intronic
1196418235 X:115496001-115496023 TTGCATCTGGATCATTTTGACGG - Intergenic
1198839569 X:140841801-140841823 ACGGATGTGAATCATGCGGAAGG - Intergenic
1200275181 X:154725293-154725315 ATGCATCTGAATCACCTGGAAGG + Intronic