ID: 1115449424

View in Genome Browser
Species Human (GRCh38)
Location 14:33529030-33529052
Sequence TTGTTCTAAGTCAAGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115449424_1115449427 -8 Left 1115449424 14:33529030-33529052 CCCCAAATCTTGACTTAGAACAA 0: 1
1: 0
2: 2
3: 11
4: 254
Right 1115449427 14:33529045-33529067 TAGAACAACACAGCTAAACAAGG 0: 1
1: 0
2: 0
3: 13
4: 216
1115449424_1115449430 15 Left 1115449424 14:33529030-33529052 CCCCAAATCTTGACTTAGAACAA 0: 1
1: 0
2: 2
3: 11
4: 254
Right 1115449430 14:33529068-33529090 TAAAATATGACTAATGCTTGGGG 0: 1
1: 0
2: 3
3: 20
4: 302
1115449424_1115449429 14 Left 1115449424 14:33529030-33529052 CCCCAAATCTTGACTTAGAACAA 0: 1
1: 0
2: 2
3: 11
4: 254
Right 1115449429 14:33529067-33529089 GTAAAATATGACTAATGCTTGGG 0: 1
1: 0
2: 0
3: 25
4: 239
1115449424_1115449428 13 Left 1115449424 14:33529030-33529052 CCCCAAATCTTGACTTAGAACAA 0: 1
1: 0
2: 2
3: 11
4: 254
Right 1115449428 14:33529066-33529088 GGTAAAATATGACTAATGCTTGG 0: 1
1: 0
2: 0
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115449424 Original CRISPR TTGTTCTAAGTCAAGATTTG GGG (reversed) Intronic
901347843 1:8562861-8562883 TTTTTCTAAGCCCAGATTTGGGG - Intronic
905153054 1:35948102-35948124 TTAATCTAAGTAAAGATCTGGGG + Intronic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
906749211 1:48243459-48243481 TTATTTTAAGACATGATTTGAGG + Intronic
906983539 1:50657394-50657416 ATGTTCTATGTTAAGACTTGAGG + Intronic
909588809 1:77322062-77322084 TTCTTCTCAGTCAATATTTTAGG - Intronic
909823007 1:80089571-80089593 TTGTTCTAGGCAAAGATTTTTGG - Intergenic
910838928 1:91542624-91542646 TTGTTGTAACTGAAGAATTGTGG - Intergenic
912220641 1:107670688-107670710 TGGGACTAAGTCAACATTTGTGG - Intronic
912307122 1:108579666-108579688 TTTTTTTAATTGAAGATTTGTGG + Intronic
914251578 1:145926245-145926267 TTTTTCTGAGTTTAGATTTGAGG - Intergenic
915933497 1:160075900-160075922 TTATTCTGAGACAAGCTTTGGGG - Intergenic
916491722 1:165307969-165307991 TTGTTCTGACTCAACATTTATGG - Intronic
916688688 1:167170865-167170887 TTGCTGGAAGTGAAGATTTGAGG - Intergenic
917983933 1:180295521-180295543 TTTTTCAAATTAAAGATTTGTGG + Intronic
919186566 1:194158973-194158995 TTGTTCTAAGTTTTTATTTGAGG + Intergenic
919545712 1:198915540-198915562 TTGTTTTAAGTGGAGATTTCTGG + Intergenic
921106591 1:211986984-211987006 TTGTTTTAATGCAAGTTTTGCGG - Intronic
921325209 1:213982008-213982030 TTGTTTTAAATAAAGATTTCTGG - Intergenic
921646350 1:217622842-217622864 ATGTTCTAAATCCTGATTTGTGG - Intronic
922044570 1:221931683-221931705 TTGTTTTAAGGCTAGTTTTGTGG - Intergenic
922389566 1:225126260-225126282 TTTTTCAAATTGAAGATTTGTGG - Intronic
924584132 1:245346799-245346821 TTGTTTTCAGTCAAGGTTTTAGG - Intronic
1063049472 10:2431064-2431086 TTTTTCTTGGTCATGATTTGGGG - Intergenic
1064248318 10:13687342-13687364 TTGTTCTAAGTGTTGTTTTGGGG - Intronic
1065910169 10:30296177-30296199 CTTTTCTAAGTCATGATTTTGGG - Intergenic
1066612183 10:37260770-37260792 TTATACTCAGTCCAGATTTGTGG - Intronic
1068416600 10:56732005-56732027 TTATTCAAAGAAAAGATTTGTGG + Intergenic
1069857142 10:71447605-71447627 GTGTTGTAAGGCTAGATTTGGGG + Intronic
1070316968 10:75323009-75323031 TTGTTCTAAGTCAAGACTGGTGG - Intergenic
1070528840 10:77318576-77318598 TGGTTCTATGTCAAGAGCTGGGG - Intronic
1071065161 10:81623806-81623828 TTGTTCTTATTCACTATTTGTGG + Intergenic
1073965902 10:108989570-108989592 TTGTCTTAAGTCTAGATTTGGGG - Intergenic
1075131481 10:119743547-119743569 TTGTTCTAAGTCTAGAATGAAGG + Intronic
1075207955 10:120462910-120462932 TTGTGTTAAGTGAAGTTTTGGGG + Intronic
1076355707 10:129851317-129851339 TTGTTTTATGTTAATATTTGTGG + Intronic
1078915464 11:15774741-15774763 TTGTTTGAAATCGAGATTTGAGG - Intergenic
1078941558 11:16012042-16012064 TTGTTTTAAGTCTAGTTTAGGGG + Intronic
1080751554 11:35155191-35155213 TTGGTCTAAGTCAAGCACTGTGG - Intronic
1081197975 11:40184789-40184811 TTATTCTAATTCAAGATTCTTGG - Intronic
1081685265 11:45038011-45038033 TTGTTTTAAACCAAGTTTTGGGG + Intergenic
1082192103 11:49258508-49258530 TAGTTCAAAGACAAGTTTTGTGG + Intergenic
1085351656 11:75801733-75801755 CAGTTCCAAGTCACGATTTGAGG + Intergenic
1085707327 11:78798560-78798582 TTATTTTAAGCCAAGATTTTCGG + Intronic
1085980313 11:81716836-81716858 TTGAACAAAGGCAAGATTTGAGG + Intergenic
1086123197 11:83322250-83322272 TTGGTCTAGGTAAAGATTTATGG - Intergenic
1086351529 11:85946780-85946802 ATGTTGTTATTCAAGATTTGAGG + Intergenic
1086674025 11:89582524-89582546 TAGTTCAAAGACAAGTTTTGTGG - Intergenic
1087769924 11:102197407-102197429 TTGTTATAATCCAAGTTTTGAGG + Intronic
1087906025 11:103698693-103698715 TTGTTCTTTTTCAAGATTTTTGG + Intergenic
1088733809 11:112708422-112708444 TTGTTCTAAGTCAATCATGGTGG + Intergenic
1088792726 11:113240502-113240524 TTGTTTTCAGTCAAGGTTTGAGG + Intronic
1090302703 11:125659336-125659358 TTTTCTTAAGTCTAGATTTGTGG + Intronic
1092647949 12:10599807-10599829 ATGTTCAAAATCAATATTTGAGG + Intergenic
1093360369 12:18218873-18218895 TTGTTCTAAGGCAAATTATGTGG - Intronic
1095420094 12:42016379-42016401 TTATTCTCAGACAAGATTTTGGG - Intergenic
1095702900 12:45208831-45208853 TAGTTCTCAGTAAATATTTGAGG + Intergenic
1096936232 12:55280716-55280738 TTGTTTTGAGTCATGTTTTGTGG + Intergenic
1098073440 12:66700441-66700463 TTTTTTTAAATTAAGATTTGGGG + Intronic
1098518158 12:71402754-71402776 TTGTTCTAATTGATGATTTTAGG - Intronic
1098551926 12:71772045-71772067 TTGTTTTAAGTCAAAAATTTTGG - Intronic
1099019791 12:77389296-77389318 TTTTGCTAAGTTGAGATTTGAGG + Intergenic
1099317739 12:81105841-81105863 ATGTTCTAAGTTAAGCTGTGTGG + Intronic
1099951288 12:89307362-89307384 TTGGTCTAAGTAACAATTTGGGG - Intergenic
1099987224 12:89680747-89680769 TTGTTCTAGGTCCAGTTTTCCGG - Intronic
1100745516 12:97641278-97641300 TCATTCTAAGTGATGATTTGGGG - Intergenic
1101204847 12:102476187-102476209 TTGTGCTCAGTACAGATTTGGGG + Intronic
1102508928 12:113401537-113401559 TTGTTTTAAGTCACATTTTGGGG + Intronic
1103437056 12:120934947-120934969 TTGTGTAAAGTCAATATTTGTGG + Intergenic
1104007463 12:124903887-124903909 TTTTTCTAATTCATCATTTGAGG + Intergenic
1105529539 13:21205493-21205515 ATGATCTAAGTATAGATTTGAGG - Intergenic
1106104300 13:26720946-26720968 TTTTTCTAAGTCATTATTTTTGG - Intergenic
1106605887 13:31228410-31228432 TTGTACTAAGCCACGTTTTGTGG - Intronic
1107263445 13:38522922-38522944 TTTTTCTAAGTCAAGGTCTTTGG + Intergenic
1108164599 13:47678866-47678888 TTGTTTTAAGTCAAGCAATGAGG - Intergenic
1109080487 13:57893527-57893549 TTTTACAAAGTAAAGATTTGTGG + Intergenic
1109303554 13:60614624-60614646 TTATTCAAAGTCAAGCTTTCTGG + Intergenic
1109417377 13:62059951-62059973 TTGTTTTAAATCAAGAATAGGGG + Intergenic
1109558812 13:64019715-64019737 TTGTTGGAAATCAAAATTTGAGG + Intergenic
1109694909 13:65941757-65941779 TGATTCTAAGTTAGGATTTGGGG - Intergenic
1109845222 13:67980373-67980395 ATATTATAAGGCAAGATTTGAGG - Intergenic
1109925007 13:69125600-69125622 TTCTTATAAGTCATGATTTTTGG - Intergenic
1109999335 13:70174625-70174647 TTTTTCGAAGTAAAGAATTGTGG - Intergenic
1110308176 13:74014887-74014909 TTTTTCTAAGTAAAGCTGTGAGG + Intronic
1111936653 13:94564661-94564683 TTGTATAAATTCAAGATTTGTGG - Intergenic
1115449424 14:33529030-33529052 TTGTTCTAAGTCAAGATTTGGGG - Intronic
1117834595 14:59790121-59790143 TTCTTCTAAGTCATTATTTCAGG - Intronic
1117926805 14:60789472-60789494 TTTTACAAATTCAAGATTTGTGG - Intronic
1118367964 14:65111628-65111650 ATGTTCTAAGACAATACTTGGGG + Intergenic
1121018806 14:90566393-90566415 TTTTACTAATTGAAGATTTGTGG - Intronic
1122360045 14:101153775-101153797 ATGTTCTATGTCCTGATTTGTGG - Intergenic
1124171535 15:27377916-27377938 TTGTGCTAGAACAAGATTTGGGG + Intronic
1124401932 15:29356121-29356143 TTGTTCTATGTGAGGATGTGAGG + Intronic
1127808756 15:62544903-62544925 TTGTGCTAAGTGGAGATTTGGGG + Intronic
1129640725 15:77375041-77375063 TTGTTTTAATTTAAGATTAGTGG - Intronic
1130020261 15:80224334-80224356 TTGTTATAAGCCAAGATTTGGGG + Intergenic
1130100513 15:80890237-80890259 TCATTCCAAGACAAGATTTGAGG + Intronic
1130200260 15:81819500-81819522 TTGTTCTAATCCACGGTTTGTGG - Intergenic
1135919932 16:26640780-26640802 TTGGTCTAAGTTAAGATATCAGG + Intergenic
1136458168 16:30394275-30394297 TAGTGCTAAGCCAAGAGTTGGGG - Intronic
1140533943 16:75691884-75691906 TTTTTGTTAGTAAAGATTTGGGG - Intronic
1141868166 16:86765399-86765421 TTGTTCGAAGTCAGGAGTTCAGG - Intergenic
1144119592 17:12138287-12138309 TTGTTAGTAGTCAAGTTTTGGGG - Intronic
1144262744 17:13538732-13538754 TTCTTTTCAATCAAGATTTGGGG + Intronic
1144644867 17:16965513-16965535 TTGTACTCAGTAAAGACTTGCGG + Intronic
1145725280 17:27115085-27115107 TTGTTCAAAATCCATATTTGCGG - Intergenic
1147518697 17:41147724-41147746 ACCTTCTAAGTCAAGATTTCGGG - Intergenic
1148087213 17:45001424-45001446 TTGTGCTCAGTAAATATTTGTGG - Intergenic
1149068639 17:52512002-52512024 TTTTTCTGAGTCAAGAATTCTGG + Intergenic
1153996417 18:10445965-10445987 TGGTTCTCAGTAAAGCTTTGTGG + Intergenic
1154386165 18:13893900-13893922 CTGTTCTAAGAATAGATTTGAGG + Intronic
1156274664 18:35572968-35572990 TTGTTGTAAGCCACAATTTGGGG + Intergenic
1161617490 19:5280055-5280077 TTGTTTTAAGTAAAAGTTTGGGG + Intronic
1162132478 19:8535597-8535619 CTGTTCTATGTCAAAATTTTTGG + Intronic
1162374121 19:10295102-10295124 GTGTTCTAATCCAGGATTTGAGG - Intronic
1162507064 19:11091891-11091913 TTGGTCTAAGTGAAGGCTTGCGG - Intronic
1164126643 19:22324446-22324468 TTCTTCTAAGGCAAGAATCGAGG - Intergenic
1167805359 19:51779685-51779707 TTGTTTTAAGCCATGTTTTGAGG - Intronic
928674861 2:33640473-33640495 TTGTTGTTGGTCAGGATTTGGGG - Intergenic
933056902 2:77681843-77681865 TGGTTTTAAGAAAAGATTTGGGG - Intergenic
933426803 2:82124018-82124040 TTGTTCAAAGTCAAAAGTTCAGG + Intergenic
933902571 2:86860636-86860658 TGGTTCAAAGTCAGGTTTTGGGG - Intronic
933927034 2:87102987-87103009 TGGTTTTAAGAAAAGATTTGAGG - Intergenic
934924084 2:98369501-98369523 TTGTCTTAAAGCAAGATTTGAGG + Intronic
935410978 2:102761773-102761795 TTGTTCAGACACAAGATTTGGGG + Intronic
935683006 2:105653974-105653996 TTTTTTTAAGTCAAGTTTTAAGG + Intergenic
940206497 2:151208184-151208206 TTGTTCAAAGGCAAAGTTTGAGG + Intergenic
940724083 2:157315116-157315138 TTGTTTTAATCCAAGATTTTGGG - Intergenic
941434461 2:165452185-165452207 CTGTGCTAAGTCAAGATCAGTGG - Intergenic
941459979 2:165759005-165759027 ATCTTCAAAGTCAAGATTTTTGG + Intronic
944193881 2:197032013-197032035 TTATTCTAGGACAGGATTTGGGG - Intronic
944202690 2:197124748-197124770 TTATTCTAAGTGTAGACTTGTGG - Intronic
948121108 2:235531109-235531131 TTGTGCTGAGTCTAGATTTGCGG - Intronic
1169952573 20:11062392-11062414 TTCTTCTAAGGAAACATTTGTGG - Intergenic
1171237709 20:23541107-23541129 TTATTCTAAATGAAGATTTTAGG + Intergenic
1174320902 20:49740771-49740793 TATTTCTAAGTAAAGAGTTGAGG - Intergenic
1174674130 20:52337086-52337108 TTGTTAGAAGTCATTATTTGTGG + Intergenic
1177102197 21:16912318-16912340 TGGTTTTAAGGCTAGATTTGTGG - Intergenic
1177219475 21:18172764-18172786 TTGTTTTAAGTCAAAATTTTTGG - Intronic
1181896102 22:26109143-26109165 TTGTTCTAAGCCACCATTTGTGG - Intergenic
950923935 3:16721643-16721665 TGTTTCTAAGTCAAGATAAGGGG - Intergenic
951388320 3:22070120-22070142 AAGTTCTAAGTGAACATTTGTGG - Intronic
951977679 3:28531273-28531295 TTGGTCTAAGCAAAGATTTTAGG + Intronic
952073442 3:29667910-29667932 ATTTTCTAAGTCAAAATTTATGG - Intronic
954954214 3:54504993-54505015 ATGTTCTAAGTCACTATTTAAGG + Intronic
955449147 3:59049274-59049296 TTGTTAAAACTCAAGATTTCTGG + Intronic
956514217 3:70028469-70028491 TTGTTCTTTGAAAAGATTTGTGG + Intergenic
957906010 3:86556602-86556624 TTTTTGTAAGTCAAGTTGTGAGG - Intergenic
958110241 3:89133072-89133094 TTATTCTAAGACAAGCTTTGAGG + Intronic
959512873 3:107233764-107233786 TGCTTACAAGTCAAGATTTGAGG + Intergenic
960606767 3:119514172-119514194 TTGTTCAAAGTAAAAAATTGAGG - Intronic
962218207 3:133541122-133541144 TTGTTTTAAGCCTAGGTTTGGGG + Intergenic
964394080 3:156227355-156227377 TTTTTCTAAGTCAAACTTTCAGG - Intronic
966579319 3:181541935-181541957 TTCCTCTAAGTGATGATTTGGGG + Intergenic
967097150 3:186186506-186186528 TTGTTGAAAATGAAGATTTGTGG - Intronic
967166202 3:186782187-186782209 ATGTTCGAAATCCAGATTTGAGG - Intergenic
967462925 3:189767056-189767078 TTGTTATATGGCAAGATTTGTGG - Intronic
969105442 4:4804035-4804057 TTATTCTATGTCATGATTTGGGG - Intergenic
971906025 4:32727017-32727039 TGGTTCTAAGTTAAAATTAGGGG + Intergenic
972392957 4:38630903-38630925 TTGTTTTCAATCAAGAGTTGGGG - Intergenic
972790189 4:42364270-42364292 TAGTTCTAAGTCAAAACTGGAGG - Intergenic
973543954 4:51961622-51961644 TGGTGCTCAGTCAACATTTGTGG - Intergenic
973554677 4:52070974-52070996 GTGTTCCTAGTTAAGATTTGTGG - Intronic
973945673 4:55952440-55952462 CTGTTCAAAGTCAACATTTCTGG + Intronic
975068125 4:70095767-70095789 CTGCTCTAAGTCAAGCATTGTGG - Intergenic
975962160 4:79923995-79924017 TTGTTTTAATTGTAGATTTGGGG + Intronic
976336816 4:83897877-83897899 TTTTTATAAGTGGAGATTTGGGG - Intergenic
977383778 4:96310975-96310997 TTGTTTAAAGTGTAGATTTGTGG - Intergenic
978243479 4:106544413-106544435 TTGGTTTAAGTCACCATTTGGGG + Intergenic
980547563 4:134287934-134287956 TTTTTTTATGTCAAAATTTGAGG - Intergenic
980768433 4:137338908-137338930 TTGTTCAAATACAAAATTTGGGG + Intergenic
981409859 4:144417335-144417357 TTGTTCTCACTCAAGAAATGGGG - Intergenic
982857610 4:160405246-160405268 TTATTTTAAATCAAGTTTTGAGG + Intergenic
983120530 4:163878482-163878504 CTTTTCTAACTCAGGATTTGGGG + Intronic
984148048 4:176089454-176089476 TGGTTCTTAGCAAAGATTTGTGG + Intronic
984165946 4:176303481-176303503 TTGTTCCAAGGTAAGTTTTGGGG - Intergenic
985908261 5:2859029-2859051 TTTTTCTAAGTTTAGGTTTGGGG + Intergenic
986934556 5:12866896-12866918 TTGTTGTAAATAAAGATCTGAGG - Intergenic
987398925 5:17454554-17454576 TTGGACTAGGTCAAGATTTCTGG + Intergenic
987532892 5:19143491-19143513 GAGCTATAAGTCAAGATTTGGGG + Intergenic
987978057 5:25041873-25041895 TTTTTCAAATTGAAGATTTGTGG + Intergenic
990193625 5:53289173-53289195 TTGTATTAAGACAAGATTTTTGG + Intergenic
990826743 5:59908803-59908825 TAATTCTTAGTCAAGATTTCTGG - Intronic
992083931 5:73261016-73261038 TTGTTTTAAGCTAAGTTTTGGGG - Intergenic
993978570 5:94513210-94513232 TTTTTCTAAGTCAAAAAATGAGG + Intronic
994870301 5:105339684-105339706 TTTTTTAAAGTAAAGATTTGTGG - Intergenic
995709813 5:115023787-115023809 TTGTTTTAAATCAAGCTTTCTGG + Intergenic
995719035 5:115110438-115110460 TTGTTCAAAGTTTAGATTTTGGG + Intergenic
997495534 5:134320909-134320931 ATGTGCTATTTCAAGATTTGTGG - Intronic
997764669 5:136488958-136488980 TTGTTTTAAGTTAAGATGTTAGG - Intergenic
999642690 5:153687859-153687881 TTGTTTTAAGTCACTGTTTGTGG - Intronic
1003402469 6:5802146-5802168 ATGATCTAAGTAGAGATTTGAGG + Intergenic
1003464994 6:6370446-6370468 TTGTTCTTAGACAAGACTTTTGG + Intergenic
1004655349 6:17654655-17654677 ATCTACTAAGTCAAAATTTGGGG - Intronic
1005039836 6:21591256-21591278 TTGTACTAACTAATGATTTGAGG - Intergenic
1005389394 6:25318111-25318133 TTGTTCTCAGTTCAGAGTTGAGG + Intronic
1006660591 6:35639707-35639729 ATGTGCTAAGTCAAATTTTGGGG - Intronic
1007979332 6:46134449-46134471 TCCTTTTAACTCAAGATTTGAGG + Intronic
1009518408 6:64649979-64650001 TTGTTCTAAATGATGATTTCTGG - Intronic
1010341748 6:74761674-74761696 TGGTTTTAAGTCAACATTTAAGG + Intergenic
1011002221 6:82603916-82603938 TTGTTCGAATTGCAGATTTGAGG - Intergenic
1011659806 6:89584548-89584570 TTGTTCTAAGCCAATAATTTAGG + Intronic
1012037969 6:94166679-94166701 TTGTACTAAATCTATATTTGTGG - Intergenic
1012182068 6:96166456-96166478 TTGTTCAAAGTAAAAACTTGTGG - Intronic
1013229123 6:108145391-108145413 TTGTTCTATTTGAAGGTTTGGGG - Intronic
1013501218 6:110753671-110753693 TTATTCTAAGCCAAGCATTGTGG - Intronic
1013796094 6:113890678-113890700 TTTTACTAATTCAAGGTTTGTGG + Intergenic
1014833727 6:126133165-126133187 TTTTTCTAAGTTAAGTTTAGTGG - Intergenic
1016149683 6:140724446-140724468 TTATTTTAAGTTAGGATTTGAGG - Intergenic
1016193543 6:141301861-141301883 TTTTTCTAATACAATATTTGAGG - Intergenic
1016540105 6:145154779-145154801 ATTTGCTAAGTAAAGATTTGTGG + Intergenic
1017350192 6:153431833-153431855 TTCTTCAAAGTCACGTTTTGTGG - Intergenic
1018136689 6:160785011-160785033 TTCTTCAAAGTCATGTTTTGTGG - Intergenic
1018154790 6:160975530-160975552 TTGTTCTAAAGCAATATATGTGG - Intergenic
1019792881 7:3028766-3028788 TTGGTTTAAGTAAAGCTTTGGGG - Intronic
1020642924 7:10778925-10778947 TTATTCTGAGTCAGGAATTGTGG + Intergenic
1021809487 7:24389633-24389655 TGGTTCTATGTCCAGATTTGTGG + Intergenic
1023008095 7:35896691-35896713 TTGTTCTAAGTTAATATGTCTGG + Intronic
1023015419 7:35964583-35964605 TTGTTCTAAGTTAATATGTCTGG + Intergenic
1023265051 7:38395840-38395862 TTGTTATAAGTGTAGATGTGTGG - Intronic
1024065523 7:45730111-45730133 TTGTTCTAAGTTAATATGTCTGG - Intergenic
1024312597 7:47983086-47983108 CTTTTCTAAATGAAGATTTGTGG + Intergenic
1026588262 7:71675408-71675430 TTGCTTTACGTCATGATTTGAGG - Intronic
1027749313 7:82121479-82121501 TTGTTCTAAGTCAAGTTGGAAGG + Intronic
1027971084 7:85083103-85083125 TTATTCTAAAGCAAGATGTGCGG - Intronic
1030421986 7:109318524-109318546 TTGGTCTGAGACAAGATTTTTGG + Intergenic
1030630732 7:111893087-111893109 TAGTACTAAGTCAATCTTTGTGG + Intronic
1032118433 7:129137735-129137757 ATATTCAAATTCAAGATTTGGGG - Intergenic
1034726553 7:153341179-153341201 TTGATTAAAGTCAATATTTGAGG - Intergenic
1035431116 7:158822881-158822903 TTGTTCTAACTTAAGTTTGGGGG - Intronic
1036964617 8:13282391-13282413 TTTTTCTATGTCATGATTTCAGG + Intronic
1037500374 8:19479745-19479767 TTTTTCTAAGTCAAGAAATACGG - Intronic
1038089138 8:24234210-24234232 CTCTTCTCAGTCAAGTTTTGTGG - Intergenic
1039230235 8:35438498-35438520 CTGTTCTAAGCAAAGATATGTGG + Intronic
1039305029 8:36252073-36252095 TTCTTCAGGGTCAAGATTTGTGG - Intergenic
1042419460 8:68568543-68568565 TTTTTCTAATTGAAGCTTTGTGG - Intronic
1043583378 8:81738874-81738896 TTGTTCAAAGTCCAAATTTCTGG - Intronic
1043833309 8:85016182-85016204 TTGGTCTCAGGCAAGATTTATGG - Intergenic
1046545535 8:115645137-115645159 TTTTTATAAATAAAGATTTGTGG - Intronic
1048254525 8:132895716-132895738 TTGTACAAAGACAGGATTTGAGG + Intronic
1048358163 8:133670797-133670819 TTCTTCTAAAGGAAGATTTGGGG + Intergenic
1048376940 8:133831170-133831192 TTGTTTTCAGTAAAGATCTGTGG + Intergenic
1048762661 8:137813332-137813354 TTGGTCTAAATCAACATTTCTGG + Intergenic
1051579909 9:18660195-18660217 CTGTTCTGAGTGAAGATGTGAGG + Intronic
1052428100 9:28330828-28330850 TTTTTCTAATCCAAAATTTGTGG - Intronic
1052591549 9:30503108-30503130 TTTATTTAAGTCCAGATTTGTGG + Intergenic
1057022011 9:91706746-91706768 TTCTGCTAAGCCATGATTTGGGG - Intronic
1057358889 9:94355502-94355524 TTCTTCTAAAAAAAGATTTGGGG + Intergenic
1058358962 9:104119497-104119519 TTGTTGTAAGCTAAGATTTCGGG - Intronic
1058976752 9:110132001-110132023 TTGTTAAAAGTCAAAGTTTGGGG - Intronic
1061547401 9:131312782-131312804 CTGTTCTCAGCCATGATTTGAGG + Intergenic
1186301489 X:8204571-8204593 ATGTCCAATGTCAAGATTTGTGG + Intergenic
1186319778 X:8411922-8411944 TTGTTTTATGTGCAGATTTGGGG + Intergenic
1187498249 X:19814639-19814661 GTGATTTAAGTCAAGACTTGAGG - Intronic
1188364047 X:29292302-29292324 TTGTCCTAAATCATGATTTTTGG + Intronic
1188936148 X:36176965-36176987 TTGTTTTAAATAAAGATTTCTGG + Intergenic
1189126031 X:38447617-38447639 TTGATCTGAGTAAAGATTTTGGG - Intronic
1189851781 X:45185103-45185125 GTGTTCTAACACAATATTTGTGG - Intronic
1194517432 X:94872100-94872122 TTAGTCTAAGTCAAGTTTAGTGG - Intergenic
1197367804 X:125586978-125587000 TTGATCTATGACAACATTTGTGG + Intergenic
1198093189 X:133352111-133352133 TTGTTCCAAGATAAGATTAGAGG - Intronic
1198229661 X:134677050-134677072 TTGTTCAAAATGTAGATTTGTGG + Intronic
1198263743 X:134990603-134990625 TTGTACTAGCTCAAGAGTTGAGG + Intergenic
1199059808 X:143341464-143341486 TTGTTATACTTCAAGATTTAGGG - Intergenic
1199221979 X:145327421-145327443 TTATTCTGCCTCAAGATTTGCGG + Intergenic
1199413600 X:147554552-147554574 TTGTTCTAGGTAAAGTTTTCTGG - Intergenic
1200303003 X:154997257-154997279 TTGCTCTGAGGCAAGATTTCTGG + Intronic
1200371818 X:155734620-155734642 TTTTTCAAATTGAAGATTTGTGG - Intergenic