ID: 1115451326

View in Genome Browser
Species Human (GRCh38)
Location 14:33551324-33551346
Sequence AGGTATTTCTTTAGGTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115451326 Original CRISPR AGGTATTTCTTTAGGTAAGG AGG (reversed) Intronic
902305188 1:15532108-15532130 AGTTATTTCTTTTGCTAATGTGG - Intronic
904504921 1:30944291-30944313 TGGTCTTTCTTTAGGGAAGGGGG - Intronic
905086664 1:35385776-35385798 ATGAAATTCTTTTGGTAAGGGGG - Intronic
906905825 1:49891010-49891032 AGGTACTACTTTAGATAAGATGG + Intronic
907956734 1:59235622-59235644 TAGTTTTACTTTAGGTAAGGTGG - Intergenic
910368409 1:86490183-86490205 TGTTATTTCTCTAGGTAGGGTGG + Intronic
918031892 1:180822417-180822439 AGGTGTTATTTTAGGTAGGGCGG - Intronic
919123105 1:193365150-193365172 AGATAATTCTCTAGGGAAGGCGG + Intergenic
919957945 1:202438275-202438297 ATTTTTTGCTTTAGGTAAGGGGG - Intronic
920411241 1:205762633-205762655 AGGTACTTCATTAGGTATGTAGG - Intergenic
921004535 1:211079995-211080017 AGGTATTTAATTAGGAAAAGAGG + Intronic
923497371 1:234537304-234537326 AGGTAATGCATTAGGTAGGGTGG - Intergenic
924063704 1:240202991-240203013 AGGTATTTCTTGAGTTATGCTGG - Intronic
924496277 1:244593312-244593334 ATGACTTTGTTTAGGTAAGGAGG - Intronic
924790216 1:247239418-247239440 AGGTATTCATTTAGGAAAAGAGG + Intergenic
1062949267 10:1485236-1485258 AGGTATTTATGTAGGTATGTAGG + Intronic
1066079180 10:31912636-31912658 AGGTATCTCTATAGAAAAGGTGG + Intronic
1068656185 10:59578432-59578454 AGGTATTTTTTTAAGAGAGGAGG - Intergenic
1068859959 10:61838029-61838051 AGCTAGTTCTTTAAGTAAGGGGG + Intergenic
1068964863 10:62901866-62901888 AGTTCTTTCTTTAGGTAAAAAGG - Intronic
1069015907 10:63428972-63428994 AGGTCTTTCTTTTGGTGGGGGGG + Intronic
1069734187 10:70641441-70641463 GGGTATTTAATTAGGAAAGGAGG - Intergenic
1069781751 10:70961358-70961380 AGGTTATTCTCCAGGTAAGGTGG + Intergenic
1070175624 10:73966985-73967007 AGGTATTTTTGTGGGGAAGGGGG + Intergenic
1070405722 10:76092955-76092977 AGGTATTTCTTTTGGTCCGTGGG + Intronic
1071864540 10:89712698-89712720 AGGTATTGTTTTATATAAGGTGG + Intronic
1073815076 10:107197618-107197640 AGGTATTTCTTTATGGTAGTGGG - Intergenic
1078272108 11:9805487-9805509 GGGTAATTCTTTAGGAAATGTGG + Intronic
1082112334 11:48291155-48291177 AGGTATTTTTTGAGGTAAAAAGG + Intergenic
1083383230 11:62285913-62285935 TGAAATTTCTTTAGATAAGGTGG - Intergenic
1083957775 11:65995400-65995422 AGGTATGTTCTTTGGTAAGGTGG - Intergenic
1084622807 11:70285009-70285031 ATGTATTTCTTTATTTAAGATGG + Intronic
1085746355 11:79117890-79117912 AGGTATGTCTGAAGGGAAGGGGG - Intronic
1087574006 11:99967369-99967391 AGGTATTTTGTTAGGTACAGGGG + Intronic
1088283693 11:108164040-108164062 AGTTATTTCTTTAAGAAAGAAGG + Intronic
1088467046 11:110151682-110151704 AGGTAATTTTCTAGGTAAGAAGG - Intronic
1090413397 11:126524318-126524340 AGGTATGTCATAAGGTCAGGTGG + Intronic
1090770516 11:129915592-129915614 AGGAATCTCTTAAGGAAAGGTGG - Intronic
1090900269 11:131024768-131024790 AGGTAATTTTATAGGTAATGAGG - Intergenic
1093648408 12:21615814-21615836 GGGTTTTTCTTTGGGTAGGGTGG - Intergenic
1094433251 12:30393624-30393646 ATGTTTTCCTTTAGGTAATGAGG + Intergenic
1096436846 12:51598895-51598917 ATGTATTTCTTAAGGAAAAGGGG - Intronic
1097396528 12:59081615-59081637 AGGCATTTCATTAGCTATGGAGG + Intergenic
1097397428 12:59092649-59092671 GGGTATTTCTTTGGTTGAGGTGG - Intergenic
1098558748 12:71849303-71849325 AAGAATCTTTTTAGGTAAGGAGG + Intronic
1099485178 12:83220965-83220987 AGTTATTTCTCTAAGTAACGTGG + Intergenic
1100214540 12:92434292-92434314 AGGTATATCAATAGGGAAGGGGG - Intergenic
1101474888 12:105035650-105035672 AGGTATTTCTTTTCATGAGGGGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105887585 13:24655265-24655287 AGGTATTTCTTTTGGTCTAGGGG + Intergenic
1106094607 13:26632136-26632158 AGGTATTTAATTAGGAAAAGAGG - Intronic
1109493417 13:63133440-63133462 AAGTATTGCTTTAAGTAAAGAGG - Intergenic
1113708743 13:112450517-112450539 AGGCAGTTCTTCAGGAAAGGCGG + Intergenic
1113961926 13:114131034-114131056 AGGGATTTCTTTTGTTAATGTGG - Intronic
1115451326 14:33551324-33551346 AGGTATTTCTTTAGGTAAGGAGG - Intronic
1119052979 14:71388916-71388938 ACCTATTTATATAGGTAAGGTGG - Intronic
1120771416 14:88384456-88384478 AAGTATCTTTTTGGGTAAGGTGG + Intergenic
1120860190 14:89248051-89248073 AGGTGTTATTTTAGGTAAAGTGG - Intronic
1121423553 14:93832462-93832484 AGGTACTTCTTTAGGTACTGGGG + Intergenic
1122457834 14:101868664-101868686 AGGTATTTCTTTTGGTCTAGGGG + Intronic
1124036274 15:26056454-26056476 AGGTATGTCTTGAGGAGAGGAGG - Intergenic
1125035136 15:35114918-35114940 ACGTATTTCATTAGATAAAGAGG + Intergenic
1126149148 15:45506753-45506775 AGGTATTTCCTGAGCTAAGAAGG - Intronic
1126259542 15:46672218-46672240 AGGTATTTATTTAGCTTAAGGGG - Intergenic
1126537297 15:49780461-49780483 AGGTATTCAATTAGGAAAGGAGG - Intergenic
1129195923 15:73966540-73966562 AGGTATTTCTTTATAGAAAGAGG - Intergenic
1129346413 15:74923085-74923107 AGATTTTTCTTTAATTAAGGTGG + Intronic
1130116356 15:81007995-81008017 AGGTTTTTCTTTTGGAGAGGGGG + Intronic
1130635948 15:85620159-85620181 TGGTATTGCTGAAGGTAAGGGGG + Intronic
1130858904 15:87868388-87868410 AGGTATTTCTTTAGGAGAATTGG - Intronic
1133776868 16:8903570-8903592 AGGTATTTATTTAGAAAAGGAGG + Intronic
1134810019 16:17159365-17159387 AGGTACTACTTTAGGTTAAGTGG - Intronic
1137253144 16:46754634-46754656 ATGTGTTTCTTTAGTTATGGAGG - Intronic
1140538426 16:75732760-75732782 AGGTATTTTTTTAAGAAAGTAGG - Intronic
1140649321 16:77069517-77069539 AGTTGTTGCTCTAGGTAAGGTGG + Intergenic
1143946777 17:10599916-10599938 AGGTACTTCTCTATGAAAGGTGG + Intergenic
1149638055 17:58185929-58185951 AGGTATTGTGTTAGGTAATGAGG + Intergenic
1156569242 18:38233864-38233886 ATGTAATGCTTTAAGTAAGGAGG + Intergenic
1159066848 18:63579011-63579033 AGATATTGCTTTAGGTACTGAGG - Intergenic
1159386709 18:67735504-67735526 GGGGATTGCTTTAGGTCAGGAGG - Intergenic
1166655413 19:44607665-44607687 TGGTTTTTTTTTAGATAAGGTGG - Intergenic
926538656 2:14146655-14146677 AGATATTTCTTTAGGGAGGCAGG + Intergenic
931339991 2:61391322-61391344 AGCTTTTTCTTTAAGTGAGGAGG + Intronic
931488624 2:62720177-62720199 AGGTATTTCTTTTGGCTTGGGGG + Intronic
931546198 2:63390719-63390741 TGGTATTTCTGTAGGATAGGTGG - Intronic
940166213 2:150775792-150775814 AGGTATTTCTTTTGGCAATGAGG + Intergenic
940786788 2:157989864-157989886 AGGTATGTCTTTGGGAAATGTGG + Intronic
943274582 2:185850228-185850250 AGGTATTTAATTAGGAAAAGAGG + Intergenic
943987631 2:194642955-194642977 AGGTATTTGATTAGGAAAAGAGG + Intergenic
944194941 2:197042541-197042563 AGGTAGTTCTTTAAATATGGAGG - Intronic
945172980 2:207016093-207016115 AGGAAATTCTTTAGTTAATGGGG + Intergenic
946586813 2:221198493-221198515 AGGTAATTCTTTAGCTCAAGGGG + Intergenic
947782265 2:232778949-232778971 AGGAATTTTTTGAGATAAGGGGG + Intronic
1172060307 20:32182822-32182844 AGGTGCTGCTCTAGGTAAGGGGG + Intergenic
1173480473 20:43394853-43394875 AGGTATTTCTTTAGGCCTTGGGG + Intergenic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1177996859 21:28110907-28110929 AGGGATTTTGTTAGGCAAGGAGG + Intergenic
1182721063 22:32400693-32400715 AGGTATTTTTTTTGGTTAGGGGG + Intronic
951012530 3:17697282-17697304 AGGTATTTAATTAGGAAAAGAGG + Intronic
951471228 3:23058582-23058604 AGGTATTCATTTAGGAAAAGAGG - Intergenic
952871553 3:37905504-37905526 AGCTATTTCTGTATGTAAGTAGG + Intronic
953281356 3:41560827-41560849 GGGTATTTAATTAGGAAAGGAGG - Intronic
954630921 3:52047257-52047279 AGGAATTTCTACAGGTAAGGAGG + Intergenic
954769511 3:52953437-52953459 AGGTTTTTTTTTTGGTGAGGGGG - Intronic
955925559 3:64000805-64000827 AGGTCTTTCTTTAGGGGTGGGGG - Exonic
956187635 3:66577589-66577611 AAGTATTTCTTTAGAAAAGGGGG + Intergenic
956448450 3:69349000-69349022 AGGTATTCATTTAGGAAAAGAGG + Intronic
956508027 3:69963424-69963446 AGGTATTTCTTTTGGTCTAGGGG - Intronic
957806678 3:85156866-85156888 AGGTATTCATTTAGGAAAAGAGG + Intronic
957896051 3:86422017-86422039 ATGTCTTTCTTTAGGAAAGGTGG + Intergenic
957986858 3:87582944-87582966 AGGTATTTCTGCATGAAAGGTGG - Intergenic
961286485 3:125809728-125809750 AGAAATTTGTTTACGTAAGGAGG + Intergenic
964519610 3:157550031-157550053 ATGTATTTTTATAGGTGAGGTGG + Intronic
964666284 3:159177531-159177553 AGGTATTTCCTGAGGTGAGATGG + Intronic
965154115 3:165024623-165024645 AAATATTTTTATAGGTAAGGAGG - Intronic
966687821 3:182715253-182715275 AGGTGTCTCTTTAGATTAGGTGG + Intergenic
966747625 3:183293232-183293254 GAGTATTTCTAGAGGTAAGGAGG + Intronic
967592654 3:191296727-191296749 AGGTCTTTCTTAAGGAAAGCGGG + Intronic
967785220 3:193485885-193485907 ATTTATTTCTTTAGTTATGGAGG - Intronic
972399898 4:38691081-38691103 AGGTTTTTTTTGAGGTAAGAGGG - Intronic
974219033 4:58942042-58942064 GGGTATTTCTGAAGATAAGGGGG + Intergenic
974371499 4:61022178-61022200 AGGTATTTAATTAGGAAAAGAGG + Intergenic
974447191 4:62000392-62000414 ATGTATTTCTTTAGGTAATGTGG + Intronic
978580073 4:110222789-110222811 AGTTAATTCTTTAGATAATGAGG + Intergenic
979352775 4:119664830-119664852 AGTTATTTATTGCGGTAAGGGGG - Intergenic
979356255 4:119709269-119709291 TGGTATTTCTAAAAGTAAGGGGG - Intergenic
980529752 4:134037786-134037808 AGGTATTTAATTAGGAAAAGAGG - Intergenic
983743386 4:171164077-171164099 AGTTATTCCTTTTGGTACGGAGG - Intergenic
986339513 5:6777157-6777179 AGGTATTTTTTTAAATTAGGAGG + Intergenic
987490246 5:18571098-18571120 GGGTAATTCTTTAGGATAGGAGG + Intergenic
989857494 5:46316389-46316411 AGGTATTCCATTAGGAAAAGAGG + Intergenic
995100830 5:108302781-108302803 AGGTTTTTCTTTAGAAAATGAGG - Intronic
995622738 5:114044936-114044958 AGGTACTTCATTAGGTACTGGGG + Intergenic
995837996 5:116417015-116417037 AGATAATTCTTTATTTAAGGGGG - Intergenic
996664102 5:126037845-126037867 AGCCATTTCTCCAGGTAAGGGGG - Intergenic
996740079 5:126790655-126790677 AGGTAATTCTTTATTTAATGAGG - Intronic
996892004 5:128432079-128432101 GGGTATTTCAATAGGTATGGAGG - Intronic
997018325 5:129964294-129964316 AGGTGTATCCTTGGGTAAGGTGG + Intronic
997862952 5:137435614-137435636 ATGTATTTCTTTAAGTAAAGTGG + Intronic
999473223 5:151874701-151874723 AGGGATATTTTTAGGTAGGGGGG + Intronic
999824840 5:155264104-155264126 AGTTCTTTCTTTAGGTAATCAGG + Intergenic
1000402389 5:160844476-160844498 ATGTATTTCTTTTGGTGTGGTGG - Intronic
1000449299 5:161364728-161364750 TGGTACTTCTTTAGGTTAAGTGG - Intronic
1003319982 6:5042885-5042907 AGGTTTTCCTTTAGGTGTGGAGG - Intergenic
1003985220 6:11428315-11428337 GGTTACTTCTTCAGGTAAGGGGG - Intergenic
1003987932 6:11455985-11456007 GGGTACTTCTTTAGGAAAAGAGG + Intergenic
1004676606 6:17848893-17848915 AGGATTTTGTTTAGGTACGGTGG - Intronic
1006258774 6:32851841-32851863 AGGTTTTTCTTAAGGTAAGGAGG + Intronic
1008800179 6:55358801-55358823 ATGTCTTTCATTAGGTGAGGGGG + Intronic
1009863522 6:69367028-69367050 AGAGATTTCTCTAGATAAGGTGG + Intronic
1011561428 6:88621061-88621083 AGGTATTTCTTTTGGCTTGGAGG + Intronic
1011866819 6:91839224-91839246 AGGTATGTATTTTGGTGAGGGGG + Intergenic
1012271714 6:97220665-97220687 AGCTGATTCTTTTGGTAAGGTGG - Intronic
1014775970 6:125510415-125510437 AGGAAATTCTCTAGGGAAGGGGG - Intergenic
1016899514 6:149087724-149087746 ATGTACTTCTTTTGGGAAGGGGG + Intergenic
1017440263 6:154458362-154458384 AGGTCTTTCATTAGGGGAGGGGG - Intronic
1021543813 7:21790616-21790638 AGGAAGTTCTTTAGTGAAGGTGG + Intronic
1022729353 7:33008030-33008052 AGGTTTTTCTTTTCATAAGGCGG - Intergenic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1024807227 7:53157245-53157267 AGGTATTTCTGAAGGGAAGAAGG + Intergenic
1030281157 7:107776979-107777001 AGTTATTCCATGAGGTAAGGTGG + Intronic
1033626508 7:143115472-143115494 AGGTATTTAATTAGGAAAAGAGG + Intergenic
1040070731 8:43185601-43185623 AGGTATTCAATTAGGAAAGGAGG - Intronic
1041387831 8:57322909-57322931 AGGTATTTGATTAGGAAAAGAGG - Intergenic
1042345518 8:67722947-67722969 AGGTTTTTCTTTTGGTGGGGAGG - Intronic
1042887947 8:73572929-73572951 GGGTATTTCATTAGGAAAAGAGG + Intronic
1043216934 8:77603755-77603777 GGGTATTTATTTAGGAAAAGAGG - Intergenic
1043320961 8:78986077-78986099 AGGCATTGCTTTAGGTAGGATGG - Intergenic
1044440458 8:92218029-92218051 AGGTATTTGATTAGGAAAAGAGG - Intergenic
1047427900 8:124763416-124763438 TTGAATTTTTTTAGGTAAGGTGG - Intergenic
1047670907 8:127145803-127145825 ATCTTTTTCTTTAGGTAATGAGG - Intergenic
1047779550 8:128100183-128100205 AGGCATTTGTTTCGGGAAGGAGG - Intergenic
1048705415 8:137147929-137147951 AGGTATTTCTTTATGGCAGTGGG - Intergenic
1049029477 8:140023772-140023794 AGGTTTTTCTTTAGGAAACCAGG - Intronic
1051970782 9:22885038-22885060 AGGTATTCATTTAGGAAAAGAGG - Intergenic
1054986920 9:71272426-71272448 TGGTATTTCTGTAGGAAAAGCGG - Intronic
1057968220 9:99525726-99525748 AGGAATTTCTGAAGGAAAGGTGG + Intergenic
1059786386 9:117590644-117590666 AAGTATTTCTAGAGGTAAAGAGG + Intergenic
1059974720 9:119703160-119703182 AGCTATTGGTTTAGGTAAGTAGG + Intergenic
1185918038 X:4057921-4057943 AGGAATTTTTTTATGTAAGCAGG + Intergenic
1188311459 X:28621739-28621761 AGGAATGTCTTTAGGGAAGGAGG + Intronic
1188930342 X:36101621-36101643 ATACATTTCTTTAGTTAAGGGGG + Intronic
1189501650 X:41566262-41566284 AGGTATTTGATTAGGAAATGAGG + Intronic
1190934482 X:54984298-54984320 AGGAATTTCTGTAGTTTAGGGGG - Intronic
1192827275 X:74710825-74710847 AAGGATTTCTTGAGGTCAGGAGG + Intergenic
1192978776 X:76316709-76316731 AGGTATTCCATTAGGAAAAGGGG - Intergenic
1194374882 X:93120109-93120131 AGTTATTTCTTTACAAAAGGAGG - Intergenic
1195377691 X:104243864-104243886 GGGTATTTCTTGAGGTACTGGGG + Intergenic
1195623446 X:106982753-106982775 AAGTATTTCTTCAGGTTGGGTGG - Intronic
1196891750 X:120298046-120298068 AGTTATTTGTTCAGGTAATGGGG - Intronic
1197627345 X:128816996-128817018 AGGTAAGTGTTTAGGTAATGAGG + Intergenic
1198635577 X:138695979-138696001 ATGTACTGCTTTAGTTAAGGTGG + Intronic
1199748862 X:150795409-150795431 AGCAAATACTTTAGGTAAGGTGG - Exonic
1200358921 X:155581351-155581373 AGGTATTTGATTAGGAAAAGAGG + Intronic
1200682903 Y:6234174-6234196 AGTTATTTCTTTACAAAAGGAGG - Intergenic
1200819895 Y:7572018-7572040 AGGTATTTAATTAGGAAAAGAGG - Intergenic
1201230236 Y:11857081-11857103 AGGTATTTAATTAGGAAAAGAGG - Intergenic