ID: 1115456626

View in Genome Browser
Species Human (GRCh38)
Location 14:33611570-33611592
Sequence ACTCTAACACTACTGCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115456624_1115456626 -8 Left 1115456624 14:33611555-33611577 CCCTCGGGAATGCTAACTCTAAC 0: 1
1: 0
2: 0
3: 5
4: 59
Right 1115456626 14:33611570-33611592 ACTCTAACACTACTGCCTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 96
1115456625_1115456626 -9 Left 1115456625 14:33611556-33611578 CCTCGGGAATGCTAACTCTAACA 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1115456626 14:33611570-33611592 ACTCTAACACTACTGCCTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 96
1115456622_1115456626 7 Left 1115456622 14:33611540-33611562 CCAGAGCTTATAATGCCCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1115456626 14:33611570-33611592 ACTCTAACACTACTGCCTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 96
1115456620_1115456626 10 Left 1115456620 14:33611537-33611559 CCTCCAGAGCTTATAATGCCCTC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1115456626 14:33611570-33611592 ACTCTAACACTACTGCCTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115456626 Original CRISPR ACTCTAACACTACTGCCTCA AGG Intronic