ID: 1115463076

View in Genome Browser
Species Human (GRCh38)
Location 14:33683880-33683902
Sequence TGTGCTCTGCATACACCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115463076_1115463080 27 Left 1115463076 14:33683880-33683902 CCTCTTGGTGTATGCAGAGCACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1115463080 14:33683930-33683952 ACACCACATCCCTCTGAGGCAGG 0: 1
1: 0
2: 5
3: 30
4: 323
1115463076_1115463079 23 Left 1115463076 14:33683880-33683902 CCTCTTGGTGTATGCAGAGCACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1115463079 14:33683926-33683948 ATTCACACCACATCCCTCTGAGG 0: 1
1: 0
2: 4
3: 43
4: 367
1115463076_1115463077 -5 Left 1115463076 14:33683880-33683902 CCTCTTGGTGTATGCAGAGCACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1115463077 14:33683898-33683920 GCACAGAAACCACTAATTACAGG 0: 1
1: 0
2: 0
3: 12
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115463076 Original CRISPR TGTGCTCTGCATACACCAAG AGG (reversed) Intronic