ID: 1115463076

View in Genome Browser
Species Human (GRCh38)
Location 14:33683880-33683902
Sequence TGTGCTCTGCATACACCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115463076_1115463077 -5 Left 1115463076 14:33683880-33683902 CCTCTTGGTGTATGCAGAGCACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1115463077 14:33683898-33683920 GCACAGAAACCACTAATTACAGG 0: 1
1: 0
2: 0
3: 12
4: 92
1115463076_1115463080 27 Left 1115463076 14:33683880-33683902 CCTCTTGGTGTATGCAGAGCACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1115463080 14:33683930-33683952 ACACCACATCCCTCTGAGGCAGG 0: 1
1: 0
2: 5
3: 30
4: 323
1115463076_1115463079 23 Left 1115463076 14:33683880-33683902 CCTCTTGGTGTATGCAGAGCACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1115463079 14:33683926-33683948 ATTCACACCACATCCCTCTGAGG 0: 1
1: 0
2: 4
3: 43
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115463076 Original CRISPR TGTGCTCTGCATACACCAAG AGG (reversed) Intronic
901192866 1:7422816-7422838 TGGGGTCTGCAAGCACCAAGTGG + Intronic
902877151 1:19347561-19347583 TGTGCACTGCATACACTATGTGG + Intronic
903933245 1:26876699-26876721 TGTTCTCTGCATATACTGAGGGG - Exonic
912086554 1:106013689-106013711 TGTGCACTGGATGCAGCAAGTGG - Intergenic
918309958 1:183278768-183278790 TCTGCTCTGCACACACTCAGGGG - Intronic
919273800 1:195385566-195385588 TGTGCTCTGTATACAAGACGTGG + Intergenic
920566159 1:206975163-206975185 TGTTCCCTGCAGAAACCAAGTGG - Intergenic
921278342 1:213541496-213541518 TATGCTTTGCAGACACCATGGGG - Intergenic
1063196578 10:3749187-3749209 TGTGCTCTGCACACCCCACTGGG - Intergenic
1064552105 10:16513063-16513085 TGAGGACTGCAGACACCAAGTGG - Exonic
1065260938 10:23922604-23922626 TGTTCTCTGTAGACACCAACTGG - Intronic
1067793931 10:49307308-49307330 TGTTCTCTGCAGACCTCAAGGGG - Intronic
1069273960 10:66566661-66566683 TGTCCTCTTCATGCTCCAAGAGG + Intronic
1075597435 10:123742323-123742345 TGTCCTCTGTATACACCAGAAGG + Intronic
1076546246 10:131247234-131247256 TGTGCTGGGCAGACACAAAGTGG + Intronic
1077007440 11:364896-364918 TATGCTCTGCCCACCCCAAGAGG - Intergenic
1082847493 11:57738486-57738508 TGTGCTCTCCATTCACTAGGAGG + Intronic
1083582739 11:63835493-63835515 TGAGCTCTGCAGACATCTAGGGG - Intergenic
1084571507 11:69962642-69962664 TGTCCTATGCCTGCACCAAGGGG + Intergenic
1085296771 11:75435811-75435833 AGTGCTCAGCAGACACCAAAGGG - Intronic
1085595134 11:77802420-77802442 ATTTCTCTGCACACACCAAGTGG - Intronic
1086551723 11:88060198-88060220 TGTTCTCTGGAGACACAAAGAGG - Intergenic
1086911181 11:92474494-92474516 TGTGCTGGGCATACAGGAAGGGG + Intronic
1088896301 11:114081131-114081153 TGTTCTCTGCTTCTACCAAGGGG + Intronic
1088971777 11:114780341-114780363 TGTGGCCTGCAAACACCACGAGG + Intergenic
1090879947 11:130824665-130824687 TGTGATCTGCTTAAACCAGGTGG - Intergenic
1096256670 12:50066100-50066122 TGTGCTCTGCATGCAACCAGAGG - Intronic
1096527515 12:52220258-52220280 AGTTCTCTGCAGACACCAACTGG + Intergenic
1098580768 12:72096319-72096341 TGTCCGCTGCAAACACAAAGAGG + Intronic
1102182541 12:110923404-110923426 TGTGCAGTGCACACATCAAGAGG + Intergenic
1105865058 13:24451721-24451743 AGTCCTATGCAGACACCAAGTGG + Intronic
1107684496 13:42883379-42883401 TATGCTTTCCATACACCAAGAGG - Intergenic
1111483112 13:88858424-88858446 TTTGCTCTGCATAGACCATTTGG + Intergenic
1112065479 13:95788275-95788297 TGTGCACTGCACAAACTAAGAGG - Intronic
1113134469 13:107074193-107074215 TGTACTGTGCACACCCCAAGGGG - Intergenic
1113926180 13:113942973-113942995 AGGGCTCAGCATCCACCAAGCGG - Intergenic
1115463076 14:33683880-33683902 TGTGCTCTGCATACACCAAGAGG - Intronic
1117836104 14:59807738-59807760 TGTCCTCTGCCTACCTCAAGTGG - Intronic
1118816951 14:69320630-69320652 AGTGCTCAGCACACACCAGGCGG - Intronic
1125647179 15:41282578-41282600 TGTGCTTGCCAAACACCAAGAGG - Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126667862 15:51091278-51091300 TCTGCTCTGCACGCACAAAGTGG + Intronic
1131988496 15:98068528-98068550 TGTGCACTGCATACCCAAGGTGG - Intergenic
1134230711 16:12427145-12427167 TAGGCTCTGCAGACCCCAAGGGG - Intronic
1135546358 16:23369603-23369625 TGACCTCTGCAACCACCAAGAGG + Intronic
1135738635 16:24954540-24954562 GGTGCTCTGGGTACAACAAGGGG + Intronic
1136345740 16:29674572-29674594 TGGGCTCTGGAAACACAAAGAGG - Intronic
1138058273 16:53859149-53859171 TGGGCTCTGCACATACAAAGGGG - Intronic
1144575699 17:16428077-16428099 TGTGCACTGCATGCAGGAAGGGG - Intronic
1148854413 17:50570876-50570898 TGGGCGCTGCAGTCACCAAGAGG + Intronic
1148892817 17:50820172-50820194 TGTGCCCTGCAGGCACAAAGGGG + Intergenic
1149509591 17:57229065-57229087 GGTGGTCTGGATAGACCAAGTGG - Intergenic
1149817621 17:59741819-59741841 TGTACTCTACATACACTATGAGG - Intronic
1149941503 17:60873151-60873173 TGTACTCTGAATACACAAAAAGG - Intronic
1152129681 17:78468525-78468547 TTTGCTCTGCATAGAGCAGGAGG - Intronic
1153984567 18:10340885-10340907 TGGGCTCTGCAGACACCCTGAGG - Intergenic
1156455053 18:37288344-37288366 GGAGCTCTGCATAAACCATGTGG - Intronic
1158489037 18:57893638-57893660 AGTTCTCTGCAGACACCAACTGG - Intergenic
1158590386 18:58774139-58774161 TGGGAGCTGCATACACCAAGTGG - Intergenic
1158642796 18:59218131-59218153 GGTGCTCTGCAGACACACAGAGG + Intergenic
1165485176 19:36091103-36091125 TGTGCTGTGCATGCAGCACGGGG + Intronic
1166331467 19:42080313-42080335 AGTGCTGGGCATGCACCAAGCGG - Exonic
927982410 2:27382354-27382376 GGTGCTCTTCACCCACCAAGAGG + Intronic
929895229 2:45953895-45953917 TGTGCTTTGCCTACATCAACTGG - Intronic
929920675 2:46169109-46169131 TGTGTTCTGCCCACATCAAGTGG + Intronic
930280887 2:49368198-49368220 TGAGCTCTGCACATGCCAAGAGG + Intergenic
930692105 2:54374845-54374867 TGTGCACTGCAAACACGCAGGGG - Intronic
935569822 2:104647420-104647442 TGTTTTCTGCATACACCAAATGG + Intergenic
936044044 2:109172468-109172490 TTTTCACTGCAAACACCAAGAGG - Intronic
937455092 2:122034361-122034383 TTTACTGAGCATACACCAAGTGG - Intergenic
938381836 2:130840679-130840701 TGTGCCCTGCATCCACCTCGTGG - Intronic
939285376 2:140122183-140122205 TGTGCTCTCCCTCCAGCAAGGGG + Intergenic
940326216 2:152427862-152427884 TGTGCACTGCACAAACCCAGGGG - Intronic
940738571 2:157480797-157480819 TGTTCTCTGCAATCAGCAAGTGG - Intronic
941659534 2:168181690-168181712 TGTGCCCTTGATACAGCAAGTGG + Intronic
948013267 2:234667251-234667273 TGTGCTCTTCAGACAGCAAATGG + Intergenic
948293013 2:236841492-236841514 TGTTCTCAGCACACACCAAGTGG + Intergenic
948372370 2:237497548-237497570 TGTGCTCTGCTCAAACCAGGTGG + Intronic
1171326382 20:24297245-24297267 GGTGATCTGCAAACTCCAAGAGG + Intergenic
1172497012 20:35394726-35394748 AGTTCTCTGCAGACACCAACTGG + Intronic
1172835730 20:37871917-37871939 TGTTCTCTGCATACTCTAGGGGG - Exonic
1178685525 21:34707727-34707749 TGTGCTCCGTATTCACAAAGGGG + Intronic
1181167283 22:20990632-20990654 TGAGCTCTGCAAACAGCAGGAGG + Intronic
1182185580 22:28398262-28398284 TGTGCTCAGGAGACACAAAGAGG + Intronic
1182374207 22:29834527-29834549 TGGTCTCTGCATACACGAGGTGG + Exonic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1184383598 22:44161743-44161765 GGTGCTGTGCATCCACCATGGGG - Intronic
1184474728 22:44714336-44714358 TGTCCTCTGCACACACTATGTGG - Intronic
950593387 3:13955814-13955836 TGTGCACTGCACACCCCAGGTGG - Intronic
950712635 3:14823780-14823802 TGTGCACTGCACACCCCAGGTGG - Intronic
952715019 3:36471784-36471806 TGTACTCTGCATACCCACAGGGG - Intronic
953996321 3:47522722-47522744 CGTGCTCTGCAGACACCTGGGGG - Intergenic
954373585 3:50183042-50183064 GGTGCTCTGGCTACAGCAAGAGG + Intronic
955604843 3:60690357-60690379 TGTGCCCTGCCAAGACCAAGTGG - Intronic
959990344 3:112624348-112624370 TGTGCTTTGCATAAGCCAGGAGG + Intronic
959994772 3:112668959-112668981 TGTGCTTTGTGTACTCCAAGGGG + Intergenic
961747061 3:129070917-129070939 TGTTCACTGCCCACACCAAGAGG - Intergenic
963109778 3:141678377-141678399 AGTGCTCTGCATACCCCACTGGG + Intergenic
963432051 3:145220007-145220029 TGAGCTCTGCAGAAACCATGAGG + Intergenic
963834582 3:150044615-150044637 TGTACCCTGCAGACACCAAAAGG + Intronic
964554959 3:157926989-157927011 TTTGCTCTGCATATACCCAAAGG - Intergenic
965774974 3:172219286-172219308 TGTGCTATGCAAAGGCCAAGAGG - Intronic
965949343 3:174286805-174286827 CTTGCCCTGCATTCACCAAGAGG - Intergenic
968082183 3:195854142-195854164 GACGCTCTGCATACAGCAAGAGG + Intergenic
968706489 4:2080682-2080704 TGTGCTGTGCAGACACCCCGAGG + Intronic
969265060 4:6059143-6059165 TGTGGTCTGCATCCTCCATGCGG - Intronic
971650161 4:29261312-29261334 TGTACTCTGCATATACCAGATGG - Intergenic
974082972 4:57231591-57231613 AGTTCTCTGCAGACACCAACTGG - Intergenic
977084769 4:92579109-92579131 TATGGTCTTCATACACCAGGAGG + Intronic
979275415 4:118809917-118809939 TGTGCCCTGCATACATCTAGGGG + Intronic
981212227 4:142121017-142121039 TGTACTCTGCCTACACTAAATGG + Intronic
981498408 4:145419473-145419495 AATGCTATGCCTACACCAAGAGG + Intergenic
985625003 5:980998-981020 TGAGGTCTGCTTACTCCAAGAGG + Intronic
986154836 5:5164354-5164376 TGTGTTCTGCATAAGTCAAGGGG + Intronic
997635742 5:135403853-135403875 TGTGCTCTGCAGACCACAATGGG + Intergenic
998387805 5:141768020-141768042 TGTGCTCGGCACACGCCGAGTGG - Intergenic
999664288 5:153896512-153896534 TGTGCTATGCTCACACTAAGTGG - Intergenic
1001616594 5:173047913-173047935 TGTGCTCTCCCTCCAGCAAGGGG + Intergenic
1002476320 5:179468601-179468623 TCTGCTGTGCAGACACCAACTGG - Intergenic
1002784745 6:392493-392515 TGGGCTCTGCAAACGACAAGTGG - Intronic
1004482175 6:16031399-16031421 TGTGCTCTGCCTACACACGGTGG + Intergenic
1005410413 6:25539346-25539368 AGTTCTCTGCATACACTAAATGG - Intronic
1005589928 6:27312531-27312553 TGTGGTCCGGATTCACCAAGTGG + Intergenic
1005886908 6:30103868-30103890 TGAGCTCTACATACAGCAGGAGG + Intronic
1006923145 6:37639237-37639259 CGTGCTCTGCATTCCCCATGGGG + Intronic
1011122378 6:83967588-83967610 TGTGGTCTGACTACACCATGAGG - Intergenic
1011122678 6:83971246-83971268 TGTGGTCTGACTACACCATGAGG - Intergenic
1013369545 6:109456833-109456855 TGTGATCTGCACACAGCAAGTGG + Intergenic
1018635809 6:165858375-165858397 TCTGCTCTGCAGTAACCAAGTGG + Intronic
1021625264 7:22586792-22586814 AGTTCTCTGCAGACACCAACTGG - Intronic
1022562789 7:31366990-31367012 TGTGCTCTGCAGAGTCCAAAAGG + Intergenic
1023506061 7:40900694-40900716 TGTGCTCTGCAAAAACCACGAGG + Intergenic
1024026308 7:45412843-45412865 TGTGCTCTGAACCCACCATGGGG + Intergenic
1024896486 7:54267374-54267396 TGTTTTCTGCATAAACCAAGTGG + Intergenic
1032653859 7:133906761-133906783 TGTGCTCCTGATCCACCAAGGGG + Intronic
1036592282 8:10179985-10180007 AGTTCTCTGCAGACACCAACTGG + Intronic
1036986269 8:13534579-13534601 TTTGCTCTGCAGACCCTAAGTGG + Intergenic
1037061867 8:14522538-14522560 TGGGCTCTGCAGACATCAAAAGG - Intronic
1040944661 8:52871600-52871622 TAAGCTCTGAATACATCAAGAGG - Intergenic
1041259199 8:56005467-56005489 TGTGGTCAGCATATACCATGAGG - Intronic
1042182848 8:66109212-66109234 TTTGCTCTGGAGCCACCAAGAGG + Intergenic
1043803663 8:84643666-84643688 TGGGCTCTGCAAGCAGCAAGTGG - Intronic
1043868544 8:85402982-85403004 AGTGCTCTGCATGAGCCAAGAGG + Intronic
1044550501 8:93506889-93506911 TGTGCTCTGCATCCATCATGTGG + Intergenic
1049165421 8:141122501-141122523 GGTGCTCTGTACACACCGAGGGG - Intronic
1053690545 9:40584630-40584652 TCTGCTCTGCATAGACCTTGGGG + Intergenic
1054258484 9:62838639-62838661 TCTGCTCAGCACACACCCAGGGG + Intergenic
1054274270 9:63052863-63052885 TCTGCTCTGCATAGACCTTGGGG - Intergenic
1054301801 9:63385604-63385626 TCTGCTCTGCATAGACCTTGGGG + Intergenic
1054400570 9:64712106-64712128 TCTGCTCTGCATAGACCTTGGGG + Intergenic
1054434176 9:65196421-65196443 TCTGCTCTGCATAGACCTTGGGG + Intergenic
1054496213 9:65825259-65825281 TCTGCTCTGCATAGACCTTGGGG - Intergenic
1056910479 9:90695941-90695963 TGTGATCAGCATACACCTGGTGG - Intergenic
1058114312 9:101067715-101067737 TGTTCTCAGCATCCACCTAGAGG - Intronic
1058661978 9:107274793-107274815 TGTGTTCTGCCTACAAGAAGCGG + Intergenic
1059338833 9:113585976-113585998 TGTGCTCCGGAATCACCAAGGGG + Intronic
1060005236 9:119993692-119993714 AGGGCTGTGCATACACCCAGGGG - Intergenic
1060517255 9:124273654-124273676 CGTGCTCTGCATTCACGAAATGG + Intronic
1060654739 9:125362682-125362704 TGTGAACTGCATCCACCAATAGG - Exonic
1061618005 9:131792775-131792797 TCTGTTCTCCAAACACCAAGTGG - Intergenic
1062086307 9:134650717-134650739 TGCCCTCTGCATCCACCAATGGG - Intronic
1203621196 Un_KI270749v1:130752-130774 TCTGCTCTGCACACACCTTGGGG + Intergenic
1189545742 X:42041218-42041240 TGTGCTTTACATTGACCAAGAGG + Intergenic
1190042238 X:47080731-47080753 GGTGCCCTGCAGACACCCAGAGG + Exonic
1191753599 X:64570298-64570320 TGTACTCTACATGCACAAAGAGG - Intergenic
1193272226 X:79543165-79543187 TGTTCTCTGCATACTCCAAAGGG + Intergenic
1195537228 X:106022680-106022702 TGAGTTCTCTATACACCAAGAGG + Intergenic
1195543249 X:106087126-106087148 AGGGCTCTGCAATCACCAAGTGG + Intergenic