ID: 1115463077

View in Genome Browser
Species Human (GRCh38)
Location 14:33683898-33683920
Sequence GCACAGAAACCACTAATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115463071_1115463077 29 Left 1115463071 14:33683846-33683868 CCCAGGCCACTGTGATAATGGTT 0: 1
1: 0
2: 1
3: 4
4: 139
Right 1115463077 14:33683898-33683920 GCACAGAAACCACTAATTACAGG 0: 1
1: 0
2: 0
3: 12
4: 92
1115463072_1115463077 28 Left 1115463072 14:33683847-33683869 CCAGGCCACTGTGATAATGGTTG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1115463077 14:33683898-33683920 GCACAGAAACCACTAATTACAGG 0: 1
1: 0
2: 0
3: 12
4: 92
1115463074_1115463077 23 Left 1115463074 14:33683852-33683874 CCACTGTGATAATGGTTGGCATT 0: 1
1: 0
2: 0
3: 8
4: 175
Right 1115463077 14:33683898-33683920 GCACAGAAACCACTAATTACAGG 0: 1
1: 0
2: 0
3: 12
4: 92
1115463076_1115463077 -5 Left 1115463076 14:33683880-33683902 CCTCTTGGTGTATGCAGAGCACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1115463077 14:33683898-33683920 GCACAGAAACCACTAATTACAGG 0: 1
1: 0
2: 0
3: 12
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115463077 Original CRISPR GCACAGAAACCACTAATTAC AGG Intronic