ID: 1115463078

View in Genome Browser
Species Human (GRCh38)
Location 14:33683907-33683929
Sequence GAATTAACTCCTGTAATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115463078_1115463080 0 Left 1115463078 14:33683907-33683929 CCACTAATTACAGGAGTTAATTC 0: 1
1: 0
2: 0
3: 31
4: 239
Right 1115463080 14:33683930-33683952 ACACCACATCCCTCTGAGGCAGG 0: 1
1: 0
2: 5
3: 30
4: 323
1115463078_1115463084 29 Left 1115463078 14:33683907-33683929 CCACTAATTACAGGAGTTAATTC 0: 1
1: 0
2: 0
3: 31
4: 239
Right 1115463084 14:33683959-33683981 TGTTATCCTTGTCTTACAGCTGG 0: 1
1: 0
2: 1
3: 23
4: 220
1115463078_1115463079 -4 Left 1115463078 14:33683907-33683929 CCACTAATTACAGGAGTTAATTC 0: 1
1: 0
2: 0
3: 31
4: 239
Right 1115463079 14:33683926-33683948 ATTCACACCACATCCCTCTGAGG 0: 1
1: 0
2: 4
3: 43
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115463078 Original CRISPR GAATTAACTCCTGTAATTAG TGG (reversed) Intronic