ID: 1115463079 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:33683926-33683948 |
| Sequence | ATTCACACCACATCCCTCTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 415 | |||
| Summary | {0: 1, 1: 0, 2: 4, 3: 43, 4: 367} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1115463078_1115463079 | -4 | Left | 1115463078 | 14:33683907-33683929 | CCACTAATTACAGGAGTTAATTC | 0: 1 1: 0 2: 0 3: 31 4: 239 |
||
| Right | 1115463079 | 14:33683926-33683948 | ATTCACACCACATCCCTCTGAGG | 0: 1 1: 0 2: 4 3: 43 4: 367 |
||||
| 1115463076_1115463079 | 23 | Left | 1115463076 | 14:33683880-33683902 | CCTCTTGGTGTATGCAGAGCACA | 0: 1 1: 0 2: 0 3: 12 4: 155 |
||
| Right | 1115463079 | 14:33683926-33683948 | ATTCACACCACATCCCTCTGAGG | 0: 1 1: 0 2: 4 3: 43 4: 367 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1115463079 | Original CRISPR | ATTCACACCACATCCCTCTG AGG | Intronic | ||