ID: 1115463080

View in Genome Browser
Species Human (GRCh38)
Location 14:33683930-33683952
Sequence ACACCACATCCCTCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 323}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115463078_1115463080 0 Left 1115463078 14:33683907-33683929 CCACTAATTACAGGAGTTAATTC 0: 1
1: 0
2: 0
3: 31
4: 239
Right 1115463080 14:33683930-33683952 ACACCACATCCCTCTGAGGCAGG 0: 1
1: 0
2: 5
3: 30
4: 323
1115463076_1115463080 27 Left 1115463076 14:33683880-33683902 CCTCTTGGTGTATGCAGAGCACA 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1115463080 14:33683930-33683952 ACACCACATCCCTCTGAGGCAGG 0: 1
1: 0
2: 5
3: 30
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115463080 Original CRISPR ACACCACATCCCTCTGAGGC AGG Intronic