ID: 1115463084

View in Genome Browser
Species Human (GRCh38)
Location 14:33683959-33683981
Sequence TGTTATCCTTGTCTTACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115463078_1115463084 29 Left 1115463078 14:33683907-33683929 CCACTAATTACAGGAGTTAATTC 0: 1
1: 0
2: 0
3: 31
4: 239
Right 1115463084 14:33683959-33683981 TGTTATCCTTGTCTTACAGCTGG 0: 1
1: 0
2: 1
3: 23
4: 220
1115463083_1115463084 -4 Left 1115463083 14:33683940-33683962 CCTCTGAGGCAGGTCAGTGTGTT 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1115463084 14:33683959-33683981 TGTTATCCTTGTCTTACAGCTGG 0: 1
1: 0
2: 1
3: 23
4: 220
1115463081_1115463084 3 Left 1115463081 14:33683933-33683955 CCACATCCCTCTGAGGCAGGTCA 0: 1
1: 0
2: 0
3: 25
4: 253
Right 1115463084 14:33683959-33683981 TGTTATCCTTGTCTTACAGCTGG 0: 1
1: 0
2: 1
3: 23
4: 220
1115463082_1115463084 -3 Left 1115463082 14:33683939-33683961 CCCTCTGAGGCAGGTCAGTGTGT 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1115463084 14:33683959-33683981 TGTTATCCTTGTCTTACAGCTGG 0: 1
1: 0
2: 1
3: 23
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115463084 Original CRISPR TGTTATCCTTGTCTTACAGC TGG Intronic