ID: 1115463329

View in Genome Browser
Species Human (GRCh38)
Location 14:33686157-33686179
Sequence CTACCTTTTGGCTCTTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115463329_1115463336 16 Left 1115463329 14:33686157-33686179 CCAACCTAAGAGCCAAAAGGTAG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1115463336 14:33686196-33686218 GACTCATCCCAGCAGCACAGTGG 0: 1
1: 0
2: 2
3: 16
4: 206
1115463329_1115463333 -8 Left 1115463329 14:33686157-33686179 CCAACCTAAGAGCCAAAAGGTAG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1115463333 14:33686172-33686194 AAAGGTAGAGGTGATCTCCCAGG 0: 1
1: 0
2: 1
3: 10
4: 138
1115463329_1115463337 17 Left 1115463329 14:33686157-33686179 CCAACCTAAGAGCCAAAAGGTAG 0: 1
1: 0
2: 1
3: 14
4: 158
Right 1115463337 14:33686197-33686219 ACTCATCCCAGCAGCACAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115463329 Original CRISPR CTACCTTTTGGCTCTTAGGT TGG (reversed) Intronic
904863845 1:33561097-33561119 TCACCATTTGGGTCTTAGGTGGG - Intronic
909248485 1:73321590-73321612 CTACTTGTGGGCACTTAGGTTGG + Intergenic
910925073 1:92389392-92389414 CTACCTTTGGTCTCTGATGTTGG - Exonic
916740455 1:167642826-167642848 CTACCTTTTGTCCCTAAGGAAGG + Intronic
916916215 1:169408887-169408909 CTACCTTTTGTCTTTGATGTTGG - Intronic
917158064 1:172025805-172025827 CTACCTTTGGTCTTTGAGGTTGG - Intronic
917248427 1:173030505-173030527 CTACCTTTGGTCTCTGATGTTGG - Intergenic
917371919 1:174301955-174301977 CTGCCTTTTGGCTTGAAGGTGGG + Intronic
917525944 1:175788668-175788690 CTGCCTGTTGGCTTTTATGTGGG - Intergenic
919269516 1:195321229-195321251 ATACCTTTTGTCTATTAGTTTGG + Intergenic
920993064 1:210959054-210959076 CTACCTTTGGTCTCTGATGTTGG + Intronic
924631538 1:245745381-245745403 CTACCTTTGGTCTCTAATGTTGG + Intergenic
1064495727 10:15908209-15908231 CTTCCTTTTGGTCCTAAGGTTGG - Intergenic
1065441588 10:25757562-25757584 CTAGCTCTTAGCTATTAGGTTGG + Intergenic
1065651849 10:27900316-27900338 CTACCTTTGGTCTTTGAGGTTGG - Intronic
1066042811 10:31567942-31567964 CTACCTTTGGTCTTTTATGTTGG + Intergenic
1067661118 10:48236765-48236787 CAACATTCTGGCTCTTAAGTTGG + Intronic
1069109709 10:64431187-64431209 CTACTTTTTGGCTTTTAAGAGGG - Intergenic
1069858148 10:71453052-71453074 CTTCCTTTTGTCACTGAGGTTGG + Intronic
1073584261 10:104693517-104693539 CTGCATTTTGGCTCTTGGGTGGG + Intronic
1074801763 10:117006719-117006741 CTACCTCTAAGCTCTTAGTTTGG + Intronic
1078283919 11:9931629-9931651 CTACCTTTTGTCTTTGATGTTGG - Intronic
1079998616 11:27322139-27322161 CTACCTTTTGTCTTTGATGTTGG - Intergenic
1081308818 11:41545709-41545731 CTACCTTTGGTCTTTGAGGTTGG - Intergenic
1081438987 11:43059541-43059563 CTACCTTTTAGCTCTTAGCTAGG - Intergenic
1085942629 11:81222941-81222963 CTCCCATGTGGCTCTCAGGTGGG + Intergenic
1087634787 11:100689899-100689921 CCACCTTTTGTCCCTTAGGAAGG + Intronic
1088078192 11:105878051-105878073 CTACCTTTTGTCTTTGATGTTGG + Intronic
1090224255 11:125059990-125060012 CTATCTTTTGACTGTTAGCTGGG + Intergenic
1090478023 11:127041687-127041709 CTATTTTTTGCCTCTTAGATTGG + Intergenic
1096460467 12:51819218-51819240 CTACCTTCTGGGTCTCAGGAAGG + Intergenic
1097515408 12:60598285-60598307 CTACATTTTGTTCCTTAGGTTGG + Intergenic
1099495163 12:83338680-83338702 CTGATTTTTGGTTCTTAGGTAGG - Intergenic
1101301621 12:103489088-103489110 CTACCTTTTGTCTTTGATGTTGG + Intronic
1106428793 13:29659270-29659292 CTACCCTCTGGCTCTTAAGTGGG + Intergenic
1107370306 13:39738135-39738157 CTAATTTTTGGTTCTTAGGAAGG + Intronic
1109216150 13:59591650-59591672 CTACCTTTGGTCTCTGATGTTGG - Intergenic
1109626543 13:64982244-64982266 CTACCTTTGGTCTTTGAGGTTGG + Intergenic
1112546400 13:100375981-100376003 CTACCTTTTGTCTTTGATGTTGG + Intronic
1115463329 14:33686157-33686179 CTACCTTTTGGCTCTTAGGTTGG - Intronic
1115515648 14:34182350-34182372 CCTCCTTGTGGCTCTGAGGTTGG - Intronic
1116079283 14:40153438-40153460 CTGGTTTTTGGCTCTTATGTAGG - Intergenic
1117892739 14:60444047-60444069 CTACCTTTGGTCTTTTATGTTGG - Intronic
1122250375 14:100434992-100435014 CTCCATTTTGGCTGTTATGTAGG + Intronic
1125732066 15:41898216-41898238 CTACCTCTGCGCTCTCAGGTGGG - Exonic
1125811819 15:42548563-42548585 CTTCCTTGTCGCTCTTGGGTCGG - Exonic
1127158144 15:56150565-56150587 CTACCTTTTGTCTTTGATGTTGG - Intronic
1127721751 15:61708754-61708776 CTACATTCTTGCTCTTAGGTTGG - Intergenic
1132096539 15:98988982-98989004 CTACCTTTGGTCTCTGATGTTGG - Intronic
1134837772 16:17376340-17376362 CTACCTCTGTCCTCTTAGGTTGG - Intronic
1136851165 16:33613547-33613569 CTTCCTTTTGCCTCTCTGGTAGG - Intergenic
1137336366 16:47553675-47553697 CTACCTTTAGTCTTTTATGTTGG + Intronic
1138910809 16:61396559-61396581 CTACACTTTGGCTTCTAGGTAGG + Intergenic
1141277771 16:82603764-82603786 ATAACATTAGGCTCTTAGGTTGG + Intergenic
1141728111 16:85803826-85803848 CTGCATTTGGGCTCCTAGGTCGG + Intronic
1203112769 16_KI270728v1_random:1462008-1462030 CTTCCTTTTGCCTCTCTGGTAGG - Intergenic
1143895215 17:10130565-10130587 CTACTTTTTGGCTCTTTAGGAGG - Intronic
1144579682 17:16451309-16451331 CTCCCTTTGAGCTCTAAGGTCGG - Intronic
1144694466 17:17292700-17292722 CTACCTTTTAGCTCTTACAAAGG + Intergenic
1146766295 17:35524706-35524728 CTACCTTTTGTCTTTGATGTTGG - Intronic
1148064874 17:44861784-44861806 CCACCTTTTGGCATTTAGGGTGG + Intronic
1148722803 17:49766560-49766582 CTACCTTTTGCCTCTCAGGCAGG - Intronic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1150522962 17:65888902-65888924 CAAACTCTTGGCTCTTAGATAGG + Intronic
1156786289 18:40919457-40919479 CTCCCTCTTGACTCTTAGGCTGG + Intergenic
1162115846 19:8428973-8428995 CTACACTCTGGCTCCTAGGTGGG - Intronic
1164516295 19:28939021-28939043 CTACCTTTGGTCTCTGATGTTGG + Intergenic
926074649 2:9932309-9932331 CTACCTTTGGTCTCTGATGTTGG + Intronic
927071120 2:19530374-19530396 CTACCCTATGGCTCTCAGCTGGG + Intergenic
931127857 2:59297560-59297582 CTACCTTCTGGCGCTAGGGTAGG - Intergenic
934079908 2:88458858-88458880 CTGCCTTCTGGCCCTGAGGTGGG - Intergenic
936998519 2:118440041-118440063 CTACCTTCTGGCTTCTAGTTGGG - Intergenic
938952201 2:136265887-136265909 CTACCTTTTGTCTTTGATGTTGG + Intergenic
940076374 2:149746694-149746716 CTCCCTGTTGGCTGTTAGGTGGG - Intergenic
942338279 2:174915053-174915075 CTACACTTTGGCTTTAAGGTTGG - Exonic
945438671 2:209851186-209851208 CTACTTTATAGCTCTCAGGTTGG + Intronic
947492232 2:230604644-230604666 CTACCTTTTGTCTTTGATGTTGG - Intergenic
1169258974 20:4121424-4121446 CTTCCTCTTGGCACTGAGGTTGG - Intronic
1169795921 20:9462264-9462286 CTACCTTTTGTCTTTGATGTTGG - Intronic
1170186270 20:13594227-13594249 CTACCTTTTGTCTTTGATGTTGG - Intronic
1172466996 20:35162565-35162587 CTACCTTTGGTCTCTGATGTTGG - Intergenic
1172782359 20:37444395-37444417 CTTCCTTTTGGGTCTCAGGTTGG + Intergenic
1175067418 20:56301304-56301326 TTCCCTTTTGTCCCTTAGGTAGG - Intergenic
1176058048 20:63159353-63159375 CTACCTTCTGTCTCTTTGGAAGG - Intergenic
1179898452 21:44376627-44376649 ATACCTTTTTCCTCATAGGTGGG + Intronic
1183864718 22:40695035-40695057 CAACCTCTTGGCTCTCAGGTGGG + Intergenic
949245163 3:1918624-1918646 CTACCTTTGGTCTCTGACGTTGG + Intergenic
949271038 3:2216904-2216926 CTACCCTTTAGCTCATTGGTGGG + Intronic
949458221 3:4262119-4262141 CTACCCTTTAGCTCTTTGCTTGG - Intronic
952502967 3:33981085-33981107 TCACCTCCTGGCTCTTAGGTAGG - Intergenic
953092482 3:39743106-39743128 CTACCTTTTGTCTTTGATGTTGG + Intergenic
953506635 3:43492015-43492037 CTACCTTTGGTCTTTGAGGTTGG - Intronic
953826692 3:46258858-46258880 CTAAATCTTGGCTCTTAAGTAGG - Intronic
954978574 3:54722551-54722573 CTACCTTTGGTCTTTTATGTTGG + Intronic
955361568 3:58280733-58280755 CTACCTTTGGTCTTTTATGTTGG + Intronic
956510644 3:69989382-69989404 CTACCTAATGGCTCTTCTGTAGG - Intergenic
956821677 3:72959610-72959632 CTTCCTTTTTCTTCTTAGGTAGG + Intronic
958656569 3:97009846-97009868 TTCCCTTGTGGCTCTCAGGTAGG + Intronic
962336083 3:134531827-134531849 CCACCTTTCTGCTTTTAGGTTGG + Exonic
962699796 3:137986173-137986195 CTTCCTTTTGGTTCTTATGAAGG + Intergenic
963276152 3:143332078-143332100 ATAGCTTTTGGCTCATAGGGAGG + Intronic
964219308 3:154325770-154325792 GTATCTCTTGGCTCTTAGGGAGG - Intergenic
965629247 3:170714009-170714031 CTTCCTTTTTGCTCTCTGGTGGG + Intronic
965737586 3:171837934-171837956 CTCCCTTTTGCCTCTTACATGGG + Intergenic
965894525 3:173559068-173559090 CTACCTTTTTGATCTTAGTTTGG + Intronic
971693517 4:29868568-29868590 CTACCTTTGGTCTTTCAGGTTGG + Intergenic
973871252 4:55169245-55169267 CTACCTTTGGTCTTTGAGGTTGG + Intergenic
974975480 4:68886278-68886300 CTACCTTTTGTCTTTGATGTTGG - Intergenic
977089624 4:92653878-92653900 ATACTTTTTGGCTATTAGGATGG + Intronic
977887319 4:102267563-102267585 CTAGCTTTTGGCATTTTGGTGGG - Exonic
978038415 4:104026540-104026562 CTAACTTCTGCCTCTTGGGTGGG - Intergenic
979163352 4:117492681-117492703 CTCCCTTTTGGCTCTGAAGAAGG + Intergenic
979326467 4:119385808-119385830 CTACCTTTTGTCTTTGATGTTGG + Intergenic
980477190 4:133333488-133333510 CTACCTTTTGTCTTTGATGTTGG + Intergenic
980584145 4:134790250-134790272 CTACCTTTTGTCTTTGATGTTGG - Intergenic
981057229 4:140375250-140375272 CTACCTTTTAGCTCTAATTTGGG - Intronic
981422077 4:144562581-144562603 CCAGCTTTTGGCTGTCAGGTAGG + Intergenic
982286431 4:153741028-153741050 CTAACTTTTGGCTATTACGCTGG + Intronic
982415705 4:155129020-155129042 TTACCTTTTCGCTCTTATTTAGG + Intergenic
982725480 4:158902128-158902150 CTACCTTTGGTCTTTTACGTTGG + Intronic
982788281 4:159560860-159560882 CTACCTTCTGTCTCTCAGGATGG - Intergenic
983244335 4:165270463-165270485 CTACCTTTTGTCTTTGATGTTGG + Intronic
985367268 4:189245134-189245156 CTACCTTTGGTCTTTGAGGTTGG + Intergenic
986896757 5:12380495-12380517 CAACAATTTGGCTCTCAGGTTGG + Intergenic
989675127 5:43965092-43965114 CTACCTTTGGTCTTTGAGGTCGG + Intergenic
990503046 5:56416176-56416198 CTTCCTTCTGGTTCTTATGTTGG + Intergenic
990668914 5:58105280-58105302 CTACCTTTTGTCTTTGAAGTCGG + Intergenic
992754811 5:79894345-79894367 GTACCTTGTGGCACATAGGTAGG - Intergenic
993345459 5:86777462-86777484 CTACCTTTGGTCTTTTATGTTGG + Intergenic
994407266 5:99360171-99360193 AGGCCTTTTGGCTCTAAGGTGGG + Intergenic
996073424 5:119161202-119161224 CTGCCTTTAGGTTCTGAGGTTGG + Intronic
1000406597 5:160894044-160894066 CTACCTTTTGTCTTTGATGTTGG - Intergenic
1000599641 5:163256805-163256827 CAACCTTTTGGCTATTTAGTTGG - Intergenic
1001030879 5:168261889-168261911 CTACCTTTTGGAACTATGGTTGG - Intronic
1003631062 6:7787865-7787887 CTTCCTTTTTGCTGATAGGTGGG + Intronic
1008254267 6:49276768-49276790 CTACCTTTTGTCTTTTATGATGG - Intergenic
1015109030 6:129569969-129569991 CTACCTTTTGTCTTTGATGTTGG - Intergenic
1019839135 7:3421683-3421705 CTTTCTGTTGGCTCTTAGATGGG + Intronic
1021607907 7:22427655-22427677 CTACCTCTAATCTCTTAGGTTGG - Intronic
1022869242 7:34458208-34458230 CTACCTTTGGTCTGTGAGGTTGG - Intergenic
1023651105 7:42370565-42370587 CTACCTTTTGTCTTTGATGTTGG + Intergenic
1027790509 7:82634381-82634403 CTACCTTTGGTCTCTGAAGTTGG - Intergenic
1027864450 7:83628926-83628948 CTACCTTTTGTCTTTGAGGTTGG + Intronic
1030468605 7:109935090-109935112 CTTTCTTTCGGCTCTTAGTTGGG + Intergenic
1033715232 7:143995396-143995418 CTACCTATTTTCTCTTATGTGGG - Intergenic
1033875272 7:145810196-145810218 CTAACTTTTGGCTCTTATGAAGG - Intergenic
1036018969 8:4820480-4820502 TTTCCTTATGGCTCTTTGGTAGG - Intronic
1040780017 8:51095969-51095991 CTACCTTTGGTCTTTTAAGTTGG - Intergenic
1041332196 8:56739044-56739066 CTGCATTTTGGCTCTGAAGTAGG + Intergenic
1041332607 8:56743561-56743583 CTACCTGCTGGGTCTTAGTTGGG + Intergenic
1043232993 8:77825796-77825818 CTACCTATTGCCTCTAAGGGTGG + Intergenic
1044067393 8:87715835-87715857 TTTCCTGTTGGCTCTTTGGTAGG + Intergenic
1045652520 8:104354274-104354296 CTACCTTCTGGAGCTTAGGGGGG - Intronic
1045839458 8:106561973-106561995 CTACCTTTGGTCTTTTATGTTGG - Intronic
1045928276 8:107596419-107596441 CTACCTTTTGTCTTTGAGGTTGG + Intergenic
1046517050 8:115276275-115276297 CTACATTTTGAATCTTAGGGTGG + Intergenic
1050492500 9:6203513-6203535 CTACCTTTTGTCTTTAATGTTGG - Intergenic
1051017831 9:12502511-12502533 CTAGCTTTTGGGGCATAGGTGGG - Intergenic
1052063862 9:23992695-23992717 CTACCTTTTGTCTTTGATGTTGG - Intergenic
1054890078 9:70241301-70241323 CTACCTTTGGTCTTTTATGTTGG - Intergenic
1056751246 9:89353016-89353038 CTACTTAGTGGCTCTTAAGTAGG - Intronic
1061725429 9:132579929-132579951 CTGGCCTTTGGCTCTTGGGTTGG - Intergenic
1186405042 X:9294440-9294462 CTCCATTTTGGCTCTTGGGCAGG + Intergenic
1187730309 X:22246056-22246078 CTACATTTTGGCTTTCAGGTGGG + Intronic
1188129902 X:26418902-26418924 CTACCTTTTGTCTTTTATGTTGG + Intergenic
1191071920 X:56410161-56410183 CTACCTTTGGTCTCTGATGTTGG + Intergenic
1191122401 X:56920275-56920297 CTACCTTTTGTCTTTGATGTTGG + Intergenic
1191762511 X:64661351-64661373 CTACCTTTTGTCTTTGATGTTGG + Intergenic
1191824265 X:65347289-65347311 CTACCTTTGGTCTCTGATGTTGG - Intergenic
1192694852 X:73402348-73402370 CTACCTTTTGTCTTTGATGTCGG - Intergenic
1193062270 X:77219825-77219847 GTACCATGTGGCTCTCAGGTGGG - Intergenic
1196012422 X:110903451-110903473 CTACCTTTTGTCTTTTATGTTGG + Intergenic
1198072273 X:133160336-133160358 CTACCTTTGGTCTTTGAGGTTGG - Intergenic
1201979246 Y:19890104-19890126 CTACCTTTGGTCTTTGAGGTTGG + Intergenic