ID: 1115469569

View in Genome Browser
Species Human (GRCh38)
Location 14:33754619-33754641
Sequence CTGAATTTCCAGAAAGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115469563_1115469569 -7 Left 1115469563 14:33754603-33754625 CCTCATCCCCATCCCACTGAATT 0: 1
1: 0
2: 6
3: 47
4: 469
Right 1115469569 14:33754619-33754641 CTGAATTTCCAGAAAGACAGAGG 0: 1
1: 0
2: 0
3: 32
4: 346
1115469562_1115469569 7 Left 1115469562 14:33754589-33754611 CCGGGAATCTGCATCCTCATCCC 0: 1
1: 0
2: 3
3: 38
4: 315
Right 1115469569 14:33754619-33754641 CTGAATTTCCAGAAAGACAGAGG 0: 1
1: 0
2: 0
3: 32
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115469569 Original CRISPR CTGAATTTCCAGAAAGACAG AGG Intronic
900498984 1:2990435-2990457 GGGAATTTTCAGAAAGCCAGGGG + Intergenic
902374261 1:16022920-16022942 CTGTATCTCCTGAAAGGCAGAGG - Intronic
902379214 1:16044797-16044819 CTGTATCTCCCGAAAGGCAGAGG - Intronic
902453426 1:16514105-16514127 TTGAAACTCCAGAAAGTCAGGGG + Intergenic
902473476 1:16666768-16666790 TTGAAACTCCAGAAAGTCAGGGG + Intergenic
902485327 1:16740674-16740696 TTGAAACTCCAGAAAGTCAGGGG - Intronic
903638554 1:24838791-24838813 TTGACTTTCCAGATATACAGTGG + Intronic
904626101 1:31803917-31803939 CTAAAGTTCCAGAAGGAGAGAGG + Intronic
904983668 1:34527041-34527063 TTGACATTCCAGAGAGACAGAGG + Intergenic
908103027 1:60810845-60810867 GTTAATTTGCAGAAATACAGAGG - Intergenic
908481524 1:64544855-64544877 CTGAATTTTCAGCAAGAAAAGGG - Intronic
909052075 1:70778152-70778174 CTGAATTTCCAGGATGTAAGTGG + Intergenic
909583050 1:77259718-77259740 TTGAAGTTTCAAAAAGACAGAGG + Intergenic
909804609 1:79858799-79858821 CTGCTTTTGCACAAAGACAGAGG - Intergenic
910236280 1:85039575-85039597 CTGCATTTCCAGAAGGAATGTGG + Intronic
910522625 1:88139941-88139963 TTGTATTTCCAGACAGGCAGAGG + Intergenic
910862426 1:91755095-91755117 CTGAATTTCCAGAGATCCCGTGG + Intronic
911169282 1:94754294-94754316 CTGGATTTCCAGTAAGAGGGAGG + Intergenic
914781076 1:150785789-150785811 AGGAAATTCCAGAAAGAGAGAGG - Intergenic
915252853 1:154602846-154602868 CAGAACTTCCAGGAATACAGAGG + Intronic
915433200 1:155882817-155882839 CGGCATTTCCAGAAAAACAAAGG - Exonic
915677149 1:157542494-157542516 CTCAATTTCCAGGAGCACAGAGG - Intronic
916213995 1:162380699-162380721 CTGGATTTCCAGATAGGGAGAGG + Intronic
917962938 1:180158771-180158793 CTGGACTTCCATGAAGACAGAGG - Intronic
918076734 1:181176300-181176322 CTAAATTGCAAGGAAGACAGAGG + Intergenic
918742933 1:188159286-188159308 CTAAATTTCAATAAATACAGTGG - Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
921342211 1:214145385-214145407 ATGTATTTGCAGAAAGGCAGAGG - Intergenic
923324313 1:232867346-232867368 TTGAGTTTCAAGAAAGAAAGAGG - Intergenic
924859690 1:247908414-247908436 TTGAGTTTCCAGAAAGAATGAGG + Intergenic
1063313663 10:4981702-4981724 CTGAATTTCCAGATCCCCAGTGG - Exonic
1063314208 10:4985487-4985509 CTGAATTTCCAGATTCCCAGTGG + Intronic
1064494006 10:15888435-15888457 GTGTATTTCCAGAAATACAGAGG - Intergenic
1065521217 10:26575254-26575276 CTATATTTACAGAAATACAGGGG + Intergenic
1065815740 10:29480964-29480986 CTGCATTTCCAGAAAGACTCTGG + Intronic
1065957189 10:30704240-30704262 CTGCATTTTCAGAAAGACTCTGG - Intergenic
1066287487 10:33982339-33982361 CTGCCTTTGCAGAAAGGCAGAGG - Intergenic
1066443699 10:35462556-35462578 TTGAACTTTCAGAAACACAGAGG + Intronic
1067317728 10:45184131-45184153 CTCAATTTCCAAAAAAACACAGG + Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069968083 10:72138390-72138412 CTAGTTTTCCAGAAAGACAAAGG - Intronic
1070469373 10:76763632-76763654 CTGACTTTCCAAAAAGCCACTGG - Intergenic
1073835182 10:107433271-107433293 CTGAATTGTCATAAGGACAGTGG - Intergenic
1074069527 10:110052209-110052231 CTTACTTTCCAGGTAGACAGAGG - Intronic
1074184848 10:111092270-111092292 CTGGATGTGCACAAAGACAGAGG + Intergenic
1075207765 10:120461875-120461897 GTGTAATTCCAGCAAGACAGAGG + Intronic
1075222982 10:120600681-120600703 CTGAATTTCAGGAAACAGAGAGG + Intergenic
1076496886 10:130903477-130903499 CTGTATTTCCAGCTGGACAGAGG - Intergenic
1080935226 11:36856525-36856547 CTGTATTTCCAGGAAGAAGGGGG + Intergenic
1081546110 11:44073013-44073035 CTGAGCTTGCAGGAAGACAGTGG + Intronic
1081671860 11:44946953-44946975 CCCAATTTCCAGAAAGGCAGAGG + Intronic
1083873127 11:65503943-65503965 TTTTATTTCCAGAAAGTCAGGGG + Intergenic
1085886749 11:80531528-80531550 CTACATTGTCAGAAAGACAGAGG + Intergenic
1087129198 11:94654061-94654083 TTGAATTTCCTGGCAGACAGAGG + Intergenic
1087982424 11:104632338-104632360 CTGAATAACCTGAAAGCCAGTGG - Intergenic
1088840353 11:113622428-113622450 GTGAAATTGGAGAAAGACAGGGG + Intergenic
1088853113 11:113721718-113721740 CTGAATGTGCAGGAAGAGAGAGG - Intergenic
1089066488 11:115665896-115665918 CTGAATTTCAATAAATCCAGAGG - Intergenic
1090250834 11:125250676-125250698 TTGAAATTTCAGAACGACAGAGG + Intronic
1090866024 11:130701434-130701456 GTGAATTTCTAGAAAGCAAGAGG - Intronic
1092086769 12:5769083-5769105 CAAAAATTCCAGAAAGGCAGAGG + Intronic
1092405016 12:8215132-8215154 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1093369841 12:18353807-18353829 CAGCCTTTCCAGAAAGGCAGTGG + Intronic
1093656274 12:21697791-21697813 CTCAATTTCCAGGAACATAGAGG - Intronic
1094824478 12:34258724-34258746 CTAAATTACCTGAAACACAGCGG + Intergenic
1095476889 12:42594623-42594645 TTGAATTCCCAGCAAGGCAGTGG - Intergenic
1096071790 12:48779667-48779689 CTGAGTTTCCAGAAACACTGAGG - Intronic
1096911128 12:54984918-54984940 CTGTTTTTCTGGAAAGACAGAGG - Intergenic
1098257196 12:68628626-68628648 CTGCTTTTCCAGAAATAAAGAGG + Intronic
1101321264 12:103675161-103675183 CTGAATTTGCAGTAAGACCTGGG + Intronic
1101982532 12:109420118-109420140 CTGAATATACAGAAACAGAGTGG - Intronic
1103094302 12:118120551-118120573 TTGAGATTACAGAAAGACAGGGG + Intronic
1103709771 12:122903652-122903674 CTGAGTTTCCAGAAAGAACCAGG - Intergenic
1105435616 13:20375713-20375735 ATGTATTTCCAGACAGAAAGCGG - Intergenic
1106866309 13:33967994-33968016 GTGAATTTACAGAAAGACAAAGG + Intergenic
1107258187 13:38456159-38456181 TTGGAGTTCCAGAAAGAAAGAGG - Intergenic
1107580282 13:41776207-41776229 CTGAATGGCCAGAGACACAGAGG - Intronic
1108782874 13:53858091-53858113 CTGCATGTCCAGAAAAACTGAGG - Intergenic
1109021115 13:57094290-57094312 TCCAATTTCCAGAAAAACAGGGG - Intergenic
1109356090 13:61231022-61231044 CCCAATTTCCAGAAAGTGAGAGG - Intergenic
1110338581 13:74362591-74362613 CTGAATTTCCTGCATGACAGAGG - Intergenic
1110621687 13:77603437-77603459 GTGTATTTCCAAAATGACAGAGG + Intronic
1110768534 13:79307883-79307905 CTGTCTTTGCAGACAGACAGAGG + Intergenic
1111279676 13:86004861-86004883 ATGAATTTCCAGAAAAATAAGGG + Intergenic
1111313084 13:86515841-86515863 CTGATTTTACAGAAATAAAGAGG + Intergenic
1111502817 13:89145415-89145437 TAGAATTTCCTGAATGACAGAGG + Intergenic
1111580193 13:90212538-90212560 CAGCATTTTAAGAAAGACAGAGG - Intergenic
1112448735 13:99490552-99490574 TTGAATTTCCTGGCAGACAGGGG - Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113742302 13:112719913-112719935 CTGAATTTCCAGAAATGAAATGG - Intronic
1114228977 14:20763405-20763427 TTGAATTCCCAGATTGACAGTGG - Intergenic
1114379914 14:22191565-22191587 CTGAATTTCATGAAATACATAGG - Intergenic
1115278351 14:31633148-31633170 CTGAATTTCCACAAACTGAGTGG - Intronic
1115336134 14:32245746-32245768 CTAAATTTCCTCACAGACAGAGG - Intergenic
1115468332 14:33740859-33740881 CCTAATTTTCAGAAAGAGAGAGG - Intronic
1115469569 14:33754619-33754641 CTGAATTTCCAGAAAGACAGAGG + Intronic
1116332335 14:43612433-43612455 CTGAATTTCCTGGCACACAGGGG + Intergenic
1116517686 14:45820138-45820160 CCTAATATCCAGAAAGAGAGAGG - Intergenic
1116519840 14:45834327-45834349 CCTAATATCCAGAAAGAGAGAGG - Intergenic
1117267554 14:54105670-54105692 CTGAATTTTCAGAAAAAAAAAGG - Intergenic
1119552778 14:75527488-75527510 TTGAATTTACAGGGAGACAGGGG - Intronic
1120139144 14:80908286-80908308 TTGCATTTCCAGAAGGAGAGGGG - Intronic
1121906743 14:97753018-97753040 CTGCATTTCCAGAAACACCTTGG + Intronic
1122760943 14:104025749-104025771 CAGAATTTCCAGAAACATAAAGG - Exonic
1125711161 15:41787800-41787822 ATGCCTTTCCAGAAAGACAGAGG - Intronic
1126095568 15:45087303-45087325 CTTGTTTTCCAGAACGACAGTGG + Intergenic
1126131549 15:45346879-45346901 GTGCATTTCCAGAGAGAAAGAGG + Intergenic
1126849838 15:52790220-52790242 CAGAATTTTAAGAAAGAGAGGGG - Intronic
1127016175 15:54690994-54691016 AAGAACTTCCAGGAAGACAGAGG + Intergenic
1127512857 15:59660011-59660033 CAGAATTTCAAGAAGGGCAGAGG + Exonic
1127715275 15:61643615-61643637 CTGAAGTTCCAGAAGTGCAGGGG - Intergenic
1128635754 15:69301309-69301331 GTGCTTTTCCAGAGAGACAGAGG + Intronic
1130617857 15:85429531-85429553 CTAAATTTCCTGAAGGCCAGAGG - Intronic
1133099590 16:3471063-3471085 GTGAATTTCAAGAAAAACACTGG - Intronic
1135796422 16:25447403-25447425 GTCAATTTCAAGAAAGAGAGTGG - Intergenic
1135959680 16:26985235-26985257 CTAAAGTTACAGAAAGAAAGTGG + Intergenic
1136092331 16:27929364-27929386 CTGAATCTCCCTAAAGACAGTGG + Intronic
1137908401 16:52350325-52350347 CTGGAGTTCCAGGAACACAGTGG + Intergenic
1138443122 16:57046948-57046970 CCCACTTTCCAGAAAGAAAGGGG + Intronic
1138852458 16:60645255-60645277 ATGAAATGCCAGAAAAACAGAGG + Intergenic
1139277334 16:65740220-65740242 CTGATTTTCCAGAAACTGAGGGG + Intergenic
1141356481 16:83351243-83351265 CTGATATTCCAGAAACACATAGG - Intronic
1141556452 16:84839668-84839690 CTGGTTTTCCAGAACTACAGAGG + Intronic
1143295512 17:5868796-5868818 GGGAATGTCCAGAAAGACAGTGG + Intronic
1144944505 17:18962913-18962935 CGGAACTTCTAGAAAGGCAGAGG + Intronic
1144949544 17:18986583-18986605 CTGAGTTTCCAGGAAGCCGGAGG - Intronic
1145260243 17:21350450-21350472 ATGCATTTTCAGAAATACAGAGG + Intergenic
1145316376 17:21737490-21737512 ATGCATTTTCAGAAATACAGAGG - Intergenic
1146954760 17:36931099-36931121 CTGCATTACCAGACAGACTGTGG + Intergenic
1147297344 17:39494673-39494695 CTGGATTTCAAGAAGGACAAAGG + Exonic
1147409201 17:40237157-40237179 CAGCGTTTCCAGAAAGAGAGAGG - Intronic
1148063619 17:44853150-44853172 CTGATTTTCCAGAAAGAAGTAGG - Intronic
1150314991 17:64161394-64161416 GAGAATTTTAAGAAAGACAGCGG - Intronic
1150315555 17:64165940-64165962 CTGAGTGTCCACACAGACAGAGG - Intronic
1151350359 17:73528211-73528233 CAAAATTCCCAGAGAGACAGGGG + Intronic
1151530277 17:74699831-74699853 CAGAATTTTGAGAAAGAGAGGGG - Intronic
1151604224 17:75126042-75126064 GTTAGTTTCCAGAAAAACAGGGG + Intronic
1153352981 18:4102204-4102226 CTTAATCACCAGAATGACAGAGG - Intronic
1155325080 18:24657000-24657022 CTGAATGGCCAGAAAGAAAATGG - Intergenic
1155840317 18:30634859-30634881 CTGCATTTAAAGAAAGACTGGGG + Intergenic
1158375675 18:56860605-56860627 CTTATTTTCAAGAAAGACTGTGG - Intronic
1158551426 18:58439324-58439346 CTGGACTTACAGGAAGACAGAGG + Intergenic
1160490757 18:79335145-79335167 CTGCATTTCCACATAGCCAGCGG - Intronic
1160589222 18:79932640-79932662 ATGACTTTCCAGAAATACAAAGG + Intronic
1163292428 19:16387963-16387985 CTGGAATCCCAGAAAGAGAGGGG + Intronic
1163920578 19:20284779-20284801 CTGAACATCCAGAATTACAGAGG + Intergenic
1164290002 19:23858973-23858995 CTGAATCTCCTGAAAAAGAGTGG - Intergenic
1164485193 19:28650093-28650115 CTGGATTCCAACAAAGACAGGGG + Intergenic
1165009847 19:32836901-32836923 ATGAATATACAGAAAAACAGGGG - Intronic
1165116152 19:33530077-33530099 CTGAATATCCAGAAAGAATGGGG - Intergenic
1165209155 19:34218999-34219021 CTGAAGTGCCAGACACACAGTGG - Intronic
1166237073 19:41464396-41464418 CTTAATATCCAGAAGGAAAGAGG - Intergenic
1166649084 19:44556783-44556805 CCTATTTTCCAGAAAGACACTGG - Intergenic
1202705667 1_KI270713v1_random:21844-21866 TTGAAACTCCAGAAAGTCAGGGG + Intergenic
925222751 2:2155329-2155351 CTTAATGTTCAGAAAGGCAGAGG - Intronic
925968783 2:9091915-9091937 TTAAATTTCCAGAAACACATTGG + Intergenic
926646044 2:15290754-15290776 ATGAACCTCCAGAAGGACAGAGG + Intronic
926727816 2:16012381-16012403 CTGAGTTTCCAGGACTACAGGGG - Intergenic
928656729 2:33459782-33459804 CTGTCTTTCCAGAGAGACTGGGG + Intronic
928817132 2:35311097-35311119 CTGATGTTCCTGGAAGACAGAGG + Intergenic
929001186 2:37348470-37348492 CTGACTTTGCAGACAGACAGAGG + Intronic
929080570 2:38118386-38118408 TGGAATTTCTAGAAATACAGTGG + Intergenic
930287777 2:49454195-49454217 CTGATTTTCTAAAGAGACAGAGG + Intergenic
930335283 2:50038014-50038036 CTACATTTCAAGAAAGAAAGAGG + Intronic
931018875 2:58019322-58019344 CTGAATTTCCTAAAAAAAAGCGG - Intronic
931228807 2:60356681-60356703 CTGCATCCCCAGAAAGAGAGAGG - Intergenic
931240395 2:60447174-60447196 CTGAAATAGGAGAAAGACAGCGG - Intergenic
932000125 2:67877453-67877475 CTGATTCTCCAGACAGGCAGAGG - Intergenic
932310352 2:70734586-70734608 CTGAAATGGAAGAAAGACAGAGG + Intronic
933178285 2:79201093-79201115 CTAAATTTCCACAAAAAAAGGGG - Intronic
935051356 2:99527719-99527741 CTTAATGTCTAGAAAAACAGTGG - Intergenic
935522183 2:104121455-104121477 ATGAATTTCTGGAAAGACGGTGG + Intergenic
935876989 2:107519709-107519731 TTGAATATGCAGAAACACAGTGG - Intergenic
935899355 2:107774169-107774191 ATGAATTTCCAGACACACATAGG + Intergenic
937248234 2:120507660-120507682 TTGATTTTCCACAAAGATAGAGG - Intergenic
938224504 2:129604349-129604371 CTGCATTTCCAGAAATCCAGTGG - Intergenic
939229104 2:139403847-139403869 CTAAATTTCCTAAAAGACAATGG - Intergenic
939654155 2:144801968-144801990 CAGAATTGTCAGAAGGACAGAGG + Intergenic
939726192 2:145724113-145724135 CCCAATTTCCTGGAAGACAGAGG - Intergenic
939728390 2:145752104-145752126 CTGACTTTCCAAAGACACAGAGG - Intergenic
939820584 2:146952595-146952617 CTGATTTTCCAGAAACAAATAGG + Intergenic
940376857 2:152967416-152967438 TTGAATTTCCTCAAAGACAGTGG - Intergenic
940761685 2:157745579-157745601 ATGAAATTCCAGGAAGTCAGGGG + Intronic
940772961 2:157858344-157858366 CAGAATTTCCTGAGAGAAAGGGG - Intronic
940822469 2:158372279-158372301 CAGAATTTCGAGACAGTCAGTGG - Intronic
942907650 2:181202978-181203000 CTTATTTGCCAGAAAGAGAGAGG + Intergenic
943709335 2:191073140-191073162 CTTCAGTTTCAGAAAGACAGAGG - Exonic
944964490 2:204914779-204914801 ATGAATTTCCAGCAGGACTGTGG + Intronic
945422294 2:209653541-209653563 CTGAAATTCCAGTCAGTCAGAGG + Intronic
945524889 2:210876132-210876154 ATGCATTTCTAGAAAGAGAGAGG + Intergenic
945542399 2:211105169-211105191 TTGAATTTCCTGAAAGACTTGGG - Intergenic
946252374 2:218421501-218421523 CTGAACTTCCAGGAAGACCAGGG - Intronic
947129198 2:226904138-226904160 CTGCCTTTCCACAAAGGCAGAGG - Intronic
947184878 2:227445901-227445923 ATAAATTTGCAGAAAGAGAGAGG - Intergenic
947959606 2:234224699-234224721 CAGAATCTGCAGAAAGAGAGGGG - Intergenic
948161754 2:235830377-235830399 CTTGATTTGAAGAAAGACAGTGG - Intronic
949041942 2:241853536-241853558 CACATTTTCCAGCAAGACAGTGG + Intronic
949042230 2:241854680-241854702 CTGCATTCCCAGAAACCCAGAGG - Intronic
1169859630 20:10137701-10137723 TTGAATTAGCAGAAAGACAAGGG + Intergenic
1170408551 20:16064827-16064849 CTGAATTTCCTGGGAGACATAGG - Intergenic
1170861875 20:20112537-20112559 CTGACTTTCCAGAAAGCCCCTGG - Intronic
1172018334 20:31893860-31893882 CTGAAGTTCAAGAAAGAGATGGG - Intronic
1172232366 20:33345550-33345572 CTGACTTTTCAGACAGACATTGG + Intergenic
1172322901 20:34010655-34010677 CTGATTTTCCAGATAAAGAGAGG + Intronic
1173527871 20:43746771-43746793 CTGAATTCCTTGGAAGACAGAGG + Intergenic
1173705326 20:45106107-45106129 GAGACTTTCCAGAAAGGCAGAGG + Intergenic
1174127398 20:48317122-48317144 CTTCACTTCCAGAAAGAGAGTGG + Intergenic
1174993771 20:55543029-55543051 CTGCATTTGCAGAAAGACAAGGG + Intergenic
1175508079 20:59501371-59501393 CCAAATTGCCAGGAAGACAGAGG + Intergenic
1175633822 20:60563884-60563906 ATGATTTCCCAGAAGGACAGGGG - Intergenic
1175917952 20:62436082-62436104 CTGAATTTTTAGAAAAAGAGTGG - Intergenic
1176664121 21:9668577-9668599 CTGAAATTCGAGAGAGACATTGG - Intergenic
1177214394 21:18109632-18109654 CTGAATCTCCAGAAAGATGAGGG - Intronic
1177675068 21:24286433-24286455 TTGTACTTCCAGAAATACAGGGG + Intergenic
1178341132 21:31786007-31786029 CTGAATTTACCGAAGGAAAGGGG - Intergenic
1178484157 21:33006565-33006587 TTTAACCTCCAGAAAGACAGGGG + Intergenic
1179151365 21:38811453-38811475 CTGCATTTCTAAAAAGAAAGCGG + Intronic
1182088129 22:27575429-27575451 CTCATTTTCCAGACAGACAAAGG - Intergenic
1182558921 22:31143746-31143768 CAGACTTCCCAGGAAGACAGTGG + Intergenic
1184845810 22:47085156-47085178 CTGTAATTCCAGCAACACAGAGG + Intronic
950271801 3:11622351-11622373 CTGAAATGCCAGAATGTCAGTGG - Intronic
950680361 3:14581049-14581071 ATGTCTATCCAGAAAGACAGAGG - Intergenic
951749518 3:26018840-26018862 CTTAAGTTCCAGGAAGACAGAGG + Intergenic
953317492 3:41942394-41942416 CTGAAATTCCAGGAACTCAGGGG + Intronic
955265663 3:57441449-57441471 CTGAAGTTCCGGAAGGAGAGAGG + Intronic
955460938 3:59182650-59182672 CTGAGTTTCCTGGAAGGCAGTGG + Intergenic
956159418 3:66333588-66333610 CTGAGCATCCAGAAAGACAGGGG - Intronic
958781220 3:98544953-98544975 ATGAAGTTCCCGAAAGACAAGGG - Intronic
959132817 3:102378673-102378695 CTGAATTTCCTGACTGACACAGG + Intronic
959429865 3:106239701-106239723 TTGAATTTGCATAAAGATAGTGG + Intergenic
960020598 3:112947925-112947947 CTGAATTTTGAAAAAGACATAGG + Intronic
962044078 3:131737067-131737089 CTGAATGTACTTAAAGACAGGGG - Intronic
964438803 3:156682244-156682266 CTGAATTTATTGAAAGAGAGTGG + Intronic
964740840 3:159964360-159964382 GAGAATGTCCAGAAAGAGAGGGG + Intergenic
964921732 3:161904930-161904952 CTCAATTTTCAGAAAACCAGTGG - Intergenic
965154658 3:165033688-165033710 CTTAATTTCCAGAAATACCTTGG - Intronic
965675935 3:171196464-171196486 CTGAATTTCCTGTAAATCAGTGG - Intronic
965694822 3:171397021-171397043 CTGAATTGCCAGAAATACACTGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
965909357 3:173752627-173752649 ATCAAGTTCCAGAAAGAGAGAGG - Intronic
966330662 3:178809149-178809171 TTGAAAGTGCAGAAAGACAGAGG + Intronic
967015419 3:185477375-185477397 TTGAATTTCCACGAAGACAGAGG + Exonic
969535242 4:7752592-7752614 CTTAATTTCCAGAGACAAAGTGG - Intergenic
970594615 4:17588887-17588909 GTGAATTTCCAAGAAGACTGGGG - Exonic
970856859 4:20659150-20659172 CTAGATTTCCTGAAAGACAGAGG + Intergenic
973792643 4:54392563-54392585 CTGACTGTCCACAAAGACTGTGG + Intergenic
973940124 4:55899472-55899494 CTGAATTTCCATATACACATGGG + Intronic
973944466 4:55942987-55943009 TTGAATTTCCTGGAAGACAGGGG - Intergenic
974154800 4:58057166-58057188 CTGAGTTTGCAGAAAGATAAAGG - Intergenic
974821360 4:67070594-67070616 GTGAATACACAGAAAGACAGAGG + Intergenic
974918693 4:68209438-68209460 CTAAATTTACAAAAATACAGTGG + Intergenic
977568546 4:98607226-98607248 CTGAGTTTTCAGAAAAACAGGGG + Intronic
979605713 4:122636773-122636795 CTGTATCTCCAGAAAACCAGGGG + Intergenic
979987721 4:127335763-127335785 TTGAATATCCAAAAAGACTGTGG + Intergenic
981054485 4:140346282-140346304 GTGATTGTCCAGAAAGACATCGG + Intronic
981763779 4:148223662-148223684 CTGAATTGGAAGAAAGAAAGAGG + Intronic
981865175 4:149409074-149409096 CTTATTTTCCAGAATGACATGGG - Intergenic
982081129 4:151791434-151791456 CTCACTTTGCAGAAAGCCAGAGG + Intergenic
983696465 4:170538659-170538681 CTTTAGTTACAGAAAGACAGGGG - Intergenic
984359716 4:178712514-178712536 GAGAATTTCCAGACAGACATAGG + Intergenic
985148510 4:186920065-186920087 CTAAAATGCCAGAAAAACAGGGG - Intergenic
985936358 5:3101006-3101028 CTGGATCTCCGGAAAGGCAGAGG + Intergenic
986386910 5:7243669-7243691 CTCCACTTCCACAAAGACAGTGG + Intergenic
989618132 5:43357664-43357686 CTGATGTTCCTGAAAGAAAGGGG + Intergenic
989774709 5:45190468-45190490 CATATTTGCCAGAAAGACAGTGG + Intergenic
991239376 5:64440194-64440216 GTGAATTTACAGAAATAGAGAGG + Intergenic
991628516 5:68630003-68630025 TTGAAGTTCCAGAAAGAATGGGG - Intergenic
995190510 5:109314807-109314829 CTTATTTTACAGAAATACAGAGG + Intergenic
996338041 5:122406269-122406291 CTGATTTACAAGAAAGACAGGGG - Intronic
996669668 5:126102045-126102067 CTGCCTTTGCAAAAAGACAGAGG - Intergenic
996896949 5:128495828-128495850 CTGACTTTACAGAAATAAAGAGG + Intronic
999253577 5:150196811-150196833 CTGATTTTCCAGACAGCCAGGGG - Exonic
1000166430 5:158653578-158653600 CTGAATTGACAGAAACACATGGG - Intergenic
1000306088 5:159995872-159995894 CTGACTTTACAGGAAGAAAGTGG - Intergenic
1000582061 5:163047151-163047173 CTGAAATTCAGGAAATACAGAGG - Intergenic
1001298778 5:170518523-170518545 ATGAACTTGCAGAAAGACACAGG + Intronic
1004203773 6:13573637-13573659 CTGAATTTCCAGCCAAACTGTGG + Intergenic
1006786929 6:36674488-36674510 GTGAATTTCCAAGAAGACTGAGG - Intergenic
1008427071 6:51371131-51371153 CTGATTGTCCATAAAGATAGAGG + Intergenic
1009227515 6:61032638-61032660 CATAATATCCAGAAAGAAAGAGG - Intergenic
1009362666 6:62834830-62834852 CTTAATATCCAGAAAGCGAGAGG + Intergenic
1009364012 6:62844194-62844216 CTGAATATCCATTAAGAGAGAGG + Intergenic
1009368081 6:62871264-62871286 CTTAATATCCAGAAGGAAAGAGG + Intergenic
1011325891 6:86149854-86149876 TTGACTTTCCAGGAAGGCAGTGG + Intergenic
1012995837 6:105973112-105973134 CTGAATTTTTAAAAAGGCAGAGG + Intergenic
1014072136 6:117194998-117195020 CTGAATGTACAGAAAAAGAGAGG - Intergenic
1014588139 6:123227358-123227380 TTGAGTTTGGAGAAAGACAGTGG + Intronic
1016544807 6:145209063-145209085 CTGAAATCTCAGAAAGACAGAGG - Intergenic
1016581807 6:145636529-145636551 CTGAAGTTTTAGAAAGACAGTGG + Intronic
1018237601 6:161741526-161741548 CTGCCTTTCTGGAAAGACAGAGG - Intronic
1018457211 6:163963092-163963114 GTCAAATTCCAGAAGGACAGCGG - Intergenic
1019586446 7:1806748-1806770 CTGAATTTCCTGACAAAAAGGGG + Intergenic
1020243473 7:6413035-6413057 CTGAAATTCCAAACAGAGAGAGG + Intronic
1020507140 7:9005472-9005494 CTGACTTTGCAGAAAGTCATAGG - Intergenic
1020826679 7:13037573-13037595 CTGAAGTTCCAGAAAGATTTGGG + Intergenic
1021525934 7:21587814-21587836 CGGAAATTGCAGACAGACAGTGG + Intronic
1022379283 7:29844573-29844595 CTCAATGGCCAGAAAGGCAGGGG - Intronic
1022393081 7:29960597-29960619 CTACTTTTCCAGAAAAACAGTGG - Intronic
1022533347 7:31080660-31080682 CTGGATGGACAGAAAGACAGCGG - Intronic
1022617536 7:31947107-31947129 CTGAAATTGCTGAAAGACACAGG - Intronic
1022651431 7:32280184-32280206 GTAAATTTGTAGAAAGACAGTGG + Intronic
1023008797 7:35906537-35906559 CTTAATTAGCAGAAAGACAGTGG - Exonic
1023016734 7:35975957-35975979 CTTTATTAGCAGAAAGACAGTGG - Intergenic
1023408910 7:39867658-39867680 CTGAATTTCAAAAAACCCAGCGG - Intergenic
1023758006 7:43438025-43438047 CTCAATTTCCAGCACGTCAGTGG - Exonic
1024143769 7:46489494-46489516 CTGAATTTCCTGCAAAACTGTGG + Intergenic
1024446892 7:49491184-49491206 CTGAATTTCCAGAACATCCGTGG + Intergenic
1024474036 7:49791871-49791893 CAGGCTTTCCAGGAAGACAGTGG - Intronic
1029683667 7:102130105-102130127 TCCAATTGCCAGAAAGACAGTGG + Intronic
1032597851 7:133259932-133259954 CTGTATTTCCAGCTGGACAGTGG - Intronic
1033140463 7:138821865-138821887 CTGTATTTCGGGAGAGACAGAGG + Intronic
1034191856 7:149219240-149219262 CTGGATTTCCCGAGTGACAGGGG - Intronic
1035072133 7:156153420-156153442 TTCAAGTTCCAGAAAGAGAGTGG - Intergenic
1035652812 8:1281658-1281680 CTGAATTTCATGAAAAACACTGG - Intergenic
1036006095 8:4665110-4665132 CTAGATTGCCAGAAATACAGAGG - Intronic
1036271211 8:7304694-7304716 CTGAATTTAAAGAAAGAAAAAGG - Intergenic
1036350138 8:8005649-8005671 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1036978672 8:13443788-13443810 ATGAATATCCAAAAACACAGAGG + Intronic
1039012672 8:33111774-33111796 ATGAATATCTCGAAAGACAGAGG + Intergenic
1043329992 8:79103840-79103862 ATTCATTTCCAGAAAAACAGGGG + Intergenic
1043447427 8:80332675-80332697 CTGAATTTCTATAAAGTTAGGGG + Intergenic
1044750550 8:95411527-95411549 CTGAAGTTCCCGAAGCACAGGGG - Intergenic
1045481321 8:102594298-102594320 CTGCCCTTCCAGAAAGGCAGAGG + Intergenic
1045845006 8:106624084-106624106 CTGACTTTCCAGAGAAACAAGGG - Intronic
1046004353 8:108461222-108461244 CTGGATATCCAGAAACACAGAGG - Intronic
1046741602 8:117835056-117835078 ATTAATTTTCAGAAAGAGAGAGG - Intronic
1047588753 8:126303614-126303636 TTGAATTTCCAGAGAGAAAGGGG + Intergenic
1048528086 8:135222725-135222747 CTTATTTTCCAGTGAGACAGAGG - Intergenic
1049054890 8:140228423-140228445 CTTAATTTCCATAAAGAAAGCGG + Intronic
1049987918 9:969879-969901 CTGACTTTCCAGAAATGCAGGGG - Intergenic
1050335325 9:4584695-4584717 CTTAATTTCCAGAGAGCCTGGGG - Intronic
1051016487 9:12481991-12482013 CTTAATTTCTAGTAAGACATTGG - Intergenic
1051306966 9:15720376-15720398 CTTAAATTCTATAAAGACAGAGG + Intronic
1051776214 9:20637059-20637081 CAGAATCTTCAGAAAGGCAGAGG + Intergenic
1052554102 9:29991008-29991030 TTGAATTTAGAGAGAGACAGTGG - Intergenic
1053564956 9:39239697-39239719 CTGAATTCACAGAAGTACAGAGG + Intronic
1054132194 9:61379342-61379364 CTGAATTCACAGAAGTACAGAGG - Intergenic
1054710108 9:68502644-68502666 CTCAATTTTCAGGAAGACTGGGG - Intronic
1055173199 9:73285934-73285956 TGGAAGTTCCACAAAGACAGGGG + Intergenic
1056165811 9:83939922-83939944 GTTAAATTCCACAAAGACAGGGG + Intronic
1056438074 9:86592344-86592366 CTGAAGTTTCAGATAGACAGAGG - Intergenic
1057126340 9:92618951-92618973 CCGAATTCCCAGAAACAGAGGGG + Exonic
1057200097 9:93135112-93135134 CTCTATTTCCAGAAGGGCAGTGG + Intergenic
1057200612 9:93137814-93137836 CCCCATTTCCAGAAGGACAGAGG + Intergenic
1058255503 9:102757148-102757170 CTGACTTACCTGACAGACAGTGG - Intergenic
1058786397 9:108393239-108393261 CTGAAAGTCCAGGAACACAGAGG + Intergenic
1058975869 9:110125225-110125247 CTGAATTGCCGAGAAGACAGTGG + Intronic
1058982269 9:110181207-110181229 CTGACTTTGCAGATAGACAGAGG + Intergenic
1060742174 9:126106334-126106356 ATGTATTTCCAGAGAGGCAGTGG + Intergenic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1060970107 9:127732940-127732962 CTGAACTTCCAGGAAGGCATCGG + Intronic
1062233956 9:135499359-135499381 CTGAGTCTACAGCAAGACAGTGG + Intronic
1062685852 9:137813006-137813028 CTGAATCCCGAGAAAGAAAGAGG - Exonic
1186096777 X:6110878-6110900 CTGAATCTGCACACAGACAGAGG + Intronic
1186239663 X:7552886-7552908 CTGAAGTTGCAGAAAAAGAGTGG - Intergenic
1188309625 X:28600382-28600404 CTGGACTTCCAGAGAGAGAGAGG + Intronic
1188991647 X:36827899-36827921 CTGAGTTTCCAGAAAGCTACTGG + Intergenic
1189672442 X:43425284-43425306 CAGAATCTCCAGAAAGACCAGGG + Intergenic
1192022125 X:67404483-67404505 GTGAGTTCCCAGAATGACAGAGG - Intergenic
1192126416 X:68504543-68504565 TAGAATTTCCTGAATGACAGAGG - Intronic
1193857609 X:86624597-86624619 CTGTGTTTCCTGAAAGACTGTGG - Intronic
1194147131 X:90278734-90278756 CTAAATTTCCTCACAGACAGAGG - Intergenic
1194436379 X:93873023-93873045 CTGCCTTTCCAAAAAGGCAGGGG + Intergenic
1195827484 X:109018047-109018069 CTCGATTTCCAGAAAGAAATTGG - Intergenic
1196189922 X:112783366-112783388 CAGACTTTCAAGAAAGTCAGAGG + Intronic
1196377053 X:115044897-115044919 CTCAATTTCAACAGAGACAGAGG + Intergenic
1196501516 X:116388564-116388586 CTGTATCTCAATAAAGACAGAGG + Intergenic
1196602282 X:117616245-117616267 TTGAGTTTCCAGAGAGGCAGAGG + Intergenic
1197739266 X:129876741-129876763 CTGCCTTTGCAGAAAGGCAGAGG + Intergenic
1197790073 X:130245725-130245747 CTGAATTTCAGGAGAGAAAGAGG - Intronic
1198230016 X:134680088-134680110 CTGAATCTTCAGAAGGACATGGG + Intronic
1198604956 X:138326956-138326978 CTGAAGTTCAACAAATACAGTGG - Intergenic
1199727206 X:150595697-150595719 CTGAATAACCTGAAAGACAATGG + Intronic
1199870967 X:151898515-151898537 CTGAACTTCCAGTACTACAGTGG - Intergenic
1200493534 Y:3855502-3855524 CTAAATTTCCTCACAGACAGAGG - Intergenic
1201492488 Y:14557418-14557440 CTGAGTTTACAGAAAGAGTGGGG + Intronic
1201788991 Y:17817013-17817035 CTGAATTTCCAGAAATGCTATGG - Intergenic
1201812562 Y:18088974-18088996 CTGAATTTCCAGAAATGCTATGG + Intergenic