ID: 1115474440

View in Genome Browser
Species Human (GRCh38)
Location 14:33800179-33800201
Sequence CGGCCTGGACGCGGGCCTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 207}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115474427_1115474440 14 Left 1115474427 14:33800142-33800164 CCAGCCGCCGGCGCCTGTCCAGC 0: 1
1: 0
2: 0
3: 23
4: 221
Right 1115474440 14:33800179-33800201 CGGCCTGGACGCGGGCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 207
1115474430_1115474440 1 Left 1115474430 14:33800155-33800177 CCTGTCCAGCGCGTCGAGCCCAG 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1115474440 14:33800179-33800201 CGGCCTGGACGCGGGCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 207
1115474428_1115474440 10 Left 1115474428 14:33800146-33800168 CCGCCGGCGCCTGTCCAGCGCGT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1115474440 14:33800179-33800201 CGGCCTGGACGCGGGCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 207
1115474433_1115474440 -4 Left 1115474433 14:33800160-33800182 CCAGCGCGTCGAGCCCAGGCGGC 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1115474440 14:33800179-33800201 CGGCCTGGACGCGGGCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 207
1115474429_1115474440 7 Left 1115474429 14:33800149-33800171 CCGGCGCCTGTCCAGCGCGTCGA 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1115474440 14:33800179-33800201 CGGCCTGGACGCGGGCCTGGTGG 0: 1
1: 0
2: 1
3: 17
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115474440 Original CRISPR CGGCCTGGACGCGGGCCTGG TGG Exonic
900184351 1:1325903-1325925 CGACCAGGAAGAGGGCCTGGGGG - Intronic
900243511 1:1627585-1627607 CGTCCTGGGGTCGGGCCTGGCGG + Intronic
900786900 1:4655156-4655178 CGGCCGGGGCGCGGGGCTCGCGG - Exonic
901217287 1:7561845-7561867 CTGCCTGCACGCCGGCCTGGAGG + Intronic
901489390 1:9588972-9588994 CGGCCTGGCCGGCGGCCTGGGGG + Exonic
901489414 1:9589084-9589106 CGGCGCGGGGGCGGGCCTGGCGG - Intronic
901800719 1:11706506-11706528 CAGCCTGGAGGCCTGCCTGGTGG - Exonic
902512752 1:16975148-16975170 TGTCCTGGAAGTGGGCCTGGTGG + Intronic
902745265 1:18469694-18469716 ACGCCTGGACCCGGGACTGGAGG - Intergenic
903044199 1:20553465-20553487 CGGCCTTGTGGCGCGCCTGGTGG - Exonic
903211887 1:21823345-21823367 CGGCCTGGGCGCGGTGCTGCAGG + Exonic
905874954 1:41426693-41426715 CGGGCTGTCCCCGGGCCTGGTGG + Intergenic
906636998 1:47416470-47416492 CGGGCCGGGCGCGGGCGTGGGGG - Exonic
912492258 1:110068985-110069007 TAGCAGGGACGCGGGCCTGGGGG + Intronic
914918507 1:151832462-151832484 AGGCCTGGAGGAGTGCCTGGAGG + Intergenic
915460229 1:156066103-156066125 CGGCGTGAGCCCGGGCCTGGGGG + Exonic
915633537 1:157170919-157170941 CGCCCTGGACTCTGGCCTGGTGG + Intergenic
915636889 1:157193818-157193840 CGCCCTGGACCCTGGTCTGGTGG + Intergenic
915671253 1:157490748-157490770 CGCCCTGGACTCTGGCCTGGTGG - Intergenic
919785069 1:201253662-201253684 AGGCCTGGACTGAGGCCTGGCGG + Intergenic
920912671 1:210233020-210233042 CGGGCTGGGCGCGGGCCGCGGGG + Intronic
923551212 1:234965416-234965438 AGTCCTGGAAGCAGGCCTGGTGG - Intergenic
923612266 1:235505276-235505298 CTGCCTCGGCGCGGGCCTGGTGG - Intergenic
924042483 1:239997714-239997736 CGGGCTCGGCGCGGGCCGGGAGG - Intergenic
1062840516 10:666720-666742 GGGTCTGGACGTGGGCCTGGGGG + Intronic
1063636468 10:7787739-7787761 GGTCCTGGACGCGGGGCTGAGGG - Intronic
1064052351 10:12069286-12069308 CGGCCTGAACGCGCGGCCGGTGG + Intronic
1065102207 10:22341387-22341409 TGACCCGGACGCGGGCTTGGTGG + Intergenic
1071531025 10:86390349-86390371 CGGCCTGGACCAGGGAGTGGAGG + Intergenic
1072421134 10:95291143-95291165 CGCCCTGCGCGCCGGCCTGGGGG + Intergenic
1074130423 10:110568260-110568282 CGGCCCGGGGGCGGCCCTGGGGG + Intronic
1075615849 10:123890760-123890782 CAGCCTGGACTCCGGCTTGGGGG - Intronic
1075645527 10:124093538-124093560 CGCCCTGGATGCGGGGCTAGAGG - Exonic
1077053154 11:576704-576726 CGCGCTGGCCGCGGGCCGGGAGG + Intronic
1077076145 11:703099-703121 CGGCCTGGAGGCCGTCCTGCAGG + Exonic
1081636690 11:44726768-44726790 AGGCCTGGACGCGGGGTTGGAGG + Intronic
1081787354 11:45756824-45756846 TGGCCTGGATGTGGCCCTGGGGG - Intergenic
1082847928 11:57741410-57741432 TGGCCTGGAGGCGGACCTTGGGG - Intronic
1083322048 11:61853935-61853957 AGGCTTGGATGAGGGCCTGGGGG - Intronic
1083429927 11:62609016-62609038 CGGCCTGGAGGAGGCCCAGGGGG - Exonic
1083624481 11:64065121-64065143 CGGGCTACACGTGGGCCTGGAGG + Intronic
1083714446 11:64567668-64567690 CGGCCCCGAAGAGGGCCTGGAGG - Exonic
1083929545 11:65833364-65833386 CGCCCTGGCCGCGGGACTTGTGG + Intronic
1084006169 11:66324791-66324813 CGTCCAGGACGCCTGCCTGGGGG - Intergenic
1084381448 11:68815770-68815792 GGGCCTGGATGCTGGCTTGGAGG - Intronic
1084381466 11:68815835-68815857 GGGCCTGGATGCTGGCTTGGAGG - Intronic
1084381489 11:68815900-68815922 GGGCCTGGATGCTGGCTTGGAGG - Intronic
1084381511 11:68815965-68815987 GGGCCTGGATGCTGGCTTGGAGG - Intronic
1084381534 11:68816030-68816052 TGGCCTGGATGCTGGCTTGGAGG - Intronic
1088630120 11:111766391-111766413 GGGCCTGGGCGCGGGGCGGGAGG - Intronic
1088971069 11:114775195-114775217 CTGCCTGAAGGCGGACCTGGAGG - Intergenic
1091550198 12:1530723-1530745 CGGCCGGGGCGCGGGGCTGGCGG - Intronic
1091666076 12:2419432-2419454 AGGACTGGAGGTGGGCCTGGTGG - Intronic
1093079127 12:14789046-14789068 CGGCCTGGTGGTGGTCCTGGAGG + Exonic
1096477629 12:51917998-51918020 CGGCCTGGAAGCTGGCCATGGGG + Intronic
1101409498 12:104457095-104457117 CTGCCTGGTCGCGGGCCGGGCGG - Exonic
1102003486 12:109573509-109573531 CGGACTGGACGGGAACCTGGCGG - Exonic
1102678514 12:114674410-114674432 CGGCTTCGCCCCGGGCCTGGCGG - Exonic
1113287876 13:108873610-108873632 TGGCCTGGACCCTGTCCTGGTGG - Intronic
1113541799 13:111115209-111115231 CGGGCCGGGCGCGGGCCGGGCGG + Intronic
1113730435 13:112637500-112637522 GGGCCTGGAGGCCGCCCTGGCGG - Intergenic
1115474440 14:33800179-33800201 CGGCCTGGACGCGGGCCTGGTGG + Exonic
1115688913 14:35824702-35824724 CGTCCGGGAGGCTGGCCTGGCGG + Intergenic
1121253120 14:92514013-92514035 CGGCCAGGACGCGGGCCGTGGGG - Intronic
1121634473 14:95444541-95444563 CGGCTTGGACCCTGACCTGGAGG + Exonic
1122151987 14:99730487-99730509 CGGCCGGGAGGCGCGCCGGGCGG + Intergenic
1122211821 14:100178517-100178539 CGGCTGGGACACAGGCCTGGTGG + Intergenic
1122359924 14:101153084-101153106 GGGCCTGGAGGGAGGCCTGGGGG - Intergenic
1122688593 14:103521405-103521427 CAGCCTGGACGGCGACCTGGCGG - Exonic
1122788150 14:104173380-104173402 CTACCTGGATGCGGCCCTGGCGG + Exonic
1123048334 14:105528903-105528925 CGTCATGGACGCGTACCTGGTGG + Exonic
1123061752 14:105597687-105597709 CGGCCTAGGCGTGGGGCTGGAGG + Intergenic
1123086490 14:105719418-105719440 CGGCCTAGGCGTGGGGCTGGAGG + Intergenic
1127763559 15:62164381-62164403 CGGAGCGGACGCGGGCCAGGCGG + Exonic
1129893951 15:79090169-79090191 CGTCCCGGCCGCGGCCCTGGGGG - Intronic
1132696137 16:1202791-1202813 CAGCCTGGACGCTTCCCTGGAGG + Intronic
1132842321 16:1984151-1984173 TGGCCTGGAGGCTGACCTGGAGG + Intronic
1132880393 16:2159528-2159550 CGGCCTGGGCTTGGGCCAGGGGG + Intronic
1132915724 16:2342077-2342099 CTGGCTGGGCGCGGGGCTGGCGG - Intergenic
1136475871 16:30513111-30513133 CGGCTTGGACTGGGGTCTGGAGG + Intronic
1136867417 16:33768934-33768956 CTGCCTGGGCGAGGGCCTGTGGG - Intergenic
1139547039 16:67654190-67654212 CCGCGTGGACGAGGGCGTGGAGG + Exonic
1139591440 16:67935452-67935474 TGGTCAGGACGCGGCCCTGGCGG - Exonic
1142005976 16:87689802-87689824 CGGGGTGGCCGCGGGGCTGGTGG - Exonic
1142215927 16:88829805-88829827 TGGCCTGGTCGCGCGCCTGAAGG - Intronic
1142292174 16:89198239-89198261 CTTCCTGGAGGCCGGCCTGGAGG - Exonic
1142693410 17:1620574-1620596 CGGCCGGGCAGAGGGCCTGGTGG - Intronic
1143099792 17:4498813-4498835 CTGATTGGGCGCGGGCCTGGTGG + Intergenic
1143509657 17:7388510-7388532 GGGCGTGGAGGCAGGCCTGGAGG - Exonic
1143592021 17:7890884-7890906 CGGCCTGGAATAGGGGCTGGAGG + Intronic
1144012286 17:11161262-11161284 AGTGCTGGAGGCGGGCCTGGTGG + Intergenic
1144756128 17:17681677-17681699 CTGCCTGGCCGCGGGCCGGCCGG + Exonic
1146003938 17:29149089-29149111 GGGCCTGGAGGCCGGCCTGGCGG - Intronic
1146909821 17:36641556-36641578 CTGACTGGACCCGGCCCTGGCGG - Intergenic
1147187234 17:38719597-38719619 CAGCCTGGAGGAGGGGCTGGGGG + Intronic
1147614681 17:41821001-41821023 AGGCCTGGACACGGGCCTGCAGG + Exonic
1148874413 17:50678171-50678193 CAGCCTGAACCCGGGGCTGGTGG + Exonic
1149610504 17:57955264-57955286 GGGCCGGGCCGCGGGCCGGGCGG + Exonic
1151791267 17:76307403-76307425 AGGCCTGGAGGGCGGCCTGGAGG + Intronic
1151962649 17:77415169-77415191 CGGCCTGGGTGAGGGCCAGGAGG + Intronic
1152744225 17:82031745-82031767 CTGCATGGGCGCGGGCCGGGCGG - Exonic
1158277094 18:55780398-55780420 CGGCCGCGAGGCGGGGCTGGAGG - Intergenic
1158404303 18:57147353-57147375 CGGCCTCGACCCGGGCCAGCGGG + Exonic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160100502 18:75916249-75916271 GGCGCTGGACGCGGGCCCGGCGG - Intergenic
1160225675 18:77009091-77009113 GGGTCTGGAGGGGGGCCTGGTGG + Intronic
1160458911 18:79022740-79022762 CTGCCTGGCCACGGGCCGGGGGG - Intergenic
1160809023 19:1005043-1005065 CGGCCTGGTCGGGGACCTGCTGG + Exonic
1160875443 19:1294440-1294462 AGGCCTGGAGGCAGGGCTGGGGG + Intronic
1161342906 19:3752672-3752694 GGGCCTGGGCGTGGCCCTGGTGG - Exonic
1161396634 19:4047991-4048013 CGCCCCGGACGCGGGGCTTGCGG + Exonic
1161554116 19:4930813-4930835 CGGCCTGGACGTGGAGCTGCAGG - Exonic
1161837823 19:6659916-6659938 GGGCCTGGAGGCGGGGCGGGGGG - Intergenic
1162403686 19:10461239-10461261 CGGGCAGGAGGCGGGGCTGGGGG + Intronic
1162403723 19:10461333-10461355 CGGGCAGGAGGCGGGGCTGGGGG + Intronic
1162900923 19:13795314-13795336 AGGCTTGGACACGGGTCTGGCGG + Intergenic
1163582253 19:18145763-18145785 CGCCCAGGAGGCGGGCCTGCGGG + Exonic
1164794213 19:31013557-31013579 GGGCCTGGGCGGGGGCCTTGGGG - Intergenic
1164886612 19:31783745-31783767 CAGCTGGGAGGCGGGCCTGGTGG - Intergenic
1165495920 19:36151936-36151958 CGCCCTGGAGTCTGGCCTGGGGG + Intronic
1166306670 19:41939673-41939695 GGGCCTGGACTCGGGTCTGAGGG - Intergenic
1166723591 19:45011970-45011992 CGGCCTGGACGGGGGACAGCCGG + Exonic
1166746778 19:45145543-45145565 CGGGCTGGGTGCGGGGCTGGGGG - Exonic
1167752023 19:51387241-51387263 CGGCCTGGACCCTGGCCGGGGGG + Exonic
1168076314 19:53982519-53982541 CAGCGTGGCCGCGGGGCTGGCGG + Exonic
1168289737 19:55351819-55351841 CGGCCTGGCCTCCAGCCTGGTGG - Intronic
925085064 2:1101263-1101285 GGGCCTGGGCCTGGGCCTGGAGG - Intronic
925917531 2:8617365-8617387 GGGCTTGGAAACGGGCCTGGTGG - Intergenic
927847944 2:26480908-26480930 GGACCTGAACGAGGGCCTGGGGG - Exonic
932767717 2:74481979-74482001 GGGCCTGGTCGGGGGCGTGGCGG - Exonic
934662411 2:96150191-96150213 GGGCCTGGGCCTGGGCCTGGGGG + Intergenic
938763299 2:134444023-134444045 TGACCTGGACCCTGGCCTGGAGG - Intronic
947741281 2:232486133-232486155 CGGCCCGGGGGTGGGCCTGGCGG - Exonic
948656165 2:239477775-239477797 CAGCCTGCATGGGGGCCTGGAGG + Intergenic
948708032 2:239807242-239807264 GGGCCTGGGTGCTGGCCTGGGGG - Intergenic
1170999391 20:21397270-21397292 CGGCCTGGGGGCGCCCCTGGGGG - Exonic
1171213555 20:23335428-23335450 TGGCCTGGACTCTGGCCTGTGGG + Intergenic
1172271425 20:33657710-33657732 CCTCCTGGACTTGGGCCTGGTGG - Exonic
1175875544 20:62227697-62227719 CGCCCTGGATGGGGGCCTGCAGG - Intergenic
1176118898 20:63445395-63445417 AGGCCTGGGGGAGGGCCTGGGGG + Intronic
1179961035 21:44767089-44767111 GGGCCTGGACCCTGGGCTGGGGG - Intergenic
1180095808 21:45555021-45555043 CGCCCTGTGCGCGCGCCTGGAGG + Intergenic
1180156013 21:45977714-45977736 TGGCCTGGATGGGGGCTTGGGGG + Intergenic
1180174402 21:46080715-46080737 CAGCCTGGTCCCGGGCCCGGGGG + Intergenic
1180997148 22:19971279-19971301 CAGCCTGACCGCGGGCCTGCTGG + Exonic
1181902781 22:26169665-26169687 CGGCCGGGCCGCGGGCATCGTGG - Exonic
1183104407 22:35606044-35606066 GGGCCTGGAAAAGGGCCTGGTGG - Intergenic
1183606049 22:38867186-38867208 CGGCCTGGGCCCGCGCCTGCGGG + Exonic
1184022894 22:41833047-41833069 CGGCCTGGAGGCGGGGCCGCAGG + Intergenic
1184046773 22:41976910-41976932 CGGCGGGGCCGCGGGCCGGGCGG + Exonic
1184783030 22:46658570-46658592 TGGCCTGGCCCCAGGCCTGGGGG - Intronic
1185039733 22:48497895-48497917 AGGCCTGGAGGCGGGGCTGAAGG + Intronic
1185214567 22:49591025-49591047 GTGCCTGGACGTGGACCTGGGGG + Intronic
1185272793 22:49936406-49936428 CGCCCTGTGGGCGGGCCTGGGGG - Intergenic
1185291978 22:50031785-50031807 CGGCGTGGACGGGTGCATGGTGG + Exonic
950013926 3:9743147-9743169 CTGCCTGGCGCCGGGCCTGGCGG - Exonic
950040200 3:9915244-9915266 CGCGCTGGGCCCGGGCCTGGTGG - Exonic
954614206 3:51961213-51961235 CGGCTCGGACGGGGGACTGGAGG - Exonic
954668930 3:52277815-52277837 CGGCCTCGACGCAGGACTGCAGG - Intronic
954822998 3:53347618-53347640 CCGCCTCTACGCGGGCCTCGCGG + Intergenic
958980124 3:100709985-100710007 TGGCCAGGAGGCGCGCCTGGGGG + Intronic
960941089 3:122935298-122935320 CTGCCTGGAAGTGGGGCTGGGGG + Intronic
963091576 3:141487506-141487528 CGGCCTGGACGCGGGGACGCTGG + Intronic
964852107 3:161105593-161105615 TGGCCTCGAGGCGGCCCTGGAGG + Intronic
966826262 3:183967498-183967520 CTGCCTGGAAGGAGGCCTGGTGG - Intronic
966910526 3:184557138-184557160 GGGCCTGGAGGGGGGCCAGGCGG + Intronic
968441040 4:624748-624770 TGGCATGGGCGCCGGCCTGGCGG - Intergenic
968896957 4:3409878-3409900 CTGCCTGGAGGGTGGCCTGGAGG - Intronic
968950718 4:3690025-3690047 CGGCCTGGGCGTGGGTCGGGCGG + Intergenic
969368669 4:6716458-6716480 GGCCCTGGACGCGAGCCTAGAGG + Exonic
969573397 4:8023160-8023182 CGGCAGGGACGCGGGCCGGGAGG - Intronic
969724684 4:8912115-8912137 TGGCCTGGCCACAGGCCTGGCGG + Intergenic
970427865 4:15962549-15962571 CAGCCTGGACCCAGGCCCGGAGG - Exonic
981067169 4:140497891-140497913 CAGGCCGGACGCGGCCCTGGAGG + Intronic
985725654 5:1514618-1514640 CGGCCTGGCGGCGTGCCTGGCGG - Intronic
988625406 5:32869672-32869694 AGGCCTGGAAGGGGGCCTGGGGG + Intergenic
990308876 5:54518903-54518925 CTGGCTGTACGCGCGCCTGGCGG + Exonic
990654272 5:57937198-57937220 GGGCCTGGACACTGACCTGGAGG - Intergenic
991025516 5:62025439-62025461 AGGCCTGAAGGCAGGCCTGGTGG + Intergenic
991026461 5:62035836-62035858 AGGCCTGAAGGCAGGCCTGGTGG + Intergenic
995388315 5:111612263-111612285 CGGGGTGGGCGCGGGCATGGCGG + Intergenic
997013534 5:129905166-129905188 CGGCGAGGACGCGAGCCTGAGGG + Exonic
1006123360 6:31821420-31821442 CGGGCTGGACGTGGGCCAGCGGG - Intergenic
1006220267 6:32484115-32484137 GGGCCTGGAGGCGGTCCTGCTGG - Intergenic
1006285580 6:33091826-33091848 CGGCCTGCTGGTGGGCCTGGCGG - Intergenic
1009912723 6:69952322-69952344 CTGCCTGGACGTGGGCATGCAGG - Intronic
1011258652 6:85449979-85450001 CAGCCTGGAGGCCGGCTTGGCGG - Intronic
1012887173 6:104859525-104859547 CAGGCTGGCCGCGGGGCTGGGGG - Intronic
1013514603 6:110874634-110874656 CTGGCTGGCCGAGGGCCTGGCGG - Intronic
1014517639 6:122399583-122399605 CGGCCTTGCCGCGCGCCTGGCGG + Exonic
1018395382 6:163374205-163374227 TGGGCTGGAAGGGGGCCTGGTGG + Intergenic
1018628683 6:165804644-165804666 TGGCCTGCAGGCGGGGCTGGTGG + Intronic
1019175848 6:170159228-170159250 ATGCCCGGACGTGGGCCTGGGGG - Intergenic
1019423523 7:962767-962789 TGGTCTGGACGTGGGGCTGGCGG - Intronic
1019481746 7:1270157-1270179 CGACCTGGGCACGGTCCTGGGGG + Intergenic
1019483358 7:1276312-1276334 GGGCCTGGGCCTGGGCCTGGGGG + Intergenic
1019558602 7:1644888-1644910 CCGCCTGGACTCTGGCCTGCAGG + Intergenic
1022109667 7:27220591-27220613 AGGCCGGGCCGCGGGGCTGGCGG + Intergenic
1022191196 7:28018229-28018251 CGGCCAGGGCACAGGCCTGGAGG + Intronic
1026804551 7:73421882-73421904 GGGCCTGGGTGTGGGCCTGGGGG - Intergenic
1029539081 7:101172588-101172610 CGGGCTGGGCGCGCGGCTGGCGG - Exonic
1031482991 7:122300479-122300501 CGCACTGGCCCCGGGCCTGGCGG + Intergenic
1033195336 7:139322524-139322546 CGGCCTGGAAGTGGGCCAAGAGG - Intergenic
1034179384 7:149126086-149126108 CGGCCGGGGCCTGGGCCTGGGGG - Intronic
1036797941 8:11769606-11769628 GGGCGTGGACTCCGGCCTGGAGG - Intergenic
1036910931 8:12755898-12755920 CGGCCTGGGCGGGGGCGTCGGGG - Intronic
1037814086 8:22102799-22102821 CGCCCTGGAGGAGGGTCTGGTGG - Exonic
1039964102 8:42271443-42271465 CGGCAGGGACGCGGGGCAGGGGG - Exonic
1040481486 8:47831529-47831551 CTGCCAGGGCGCGGGCCTTGAGG + Intronic
1047222940 8:122933071-122933093 TGGCCTGGAGGCGGGGATGGAGG + Intronic
1049001328 8:139827194-139827216 CGGCCTGGAGCAGGGCCTCGCGG + Intronic
1049212291 8:141392266-141392288 CGGCGGGAACGTGGGCCTGGAGG + Intronic
1049418008 8:142504333-142504355 CAGCCAGGACCAGGGCCTGGAGG + Intronic
1049936428 9:504943-504965 CGGCCTCGGGGCGGTCCTGGGGG + Intronic
1052988078 9:34502365-34502387 GGGCCTGGAACAGGGCCTGGGGG + Intronic
1056623747 9:88236985-88237007 AGGCCTGGCCGAGGGCCTAGTGG - Intergenic
1060106436 9:120876317-120876339 CGGCCTGGCCCCTGGCCGGGCGG - Intronic
1062091354 9:134680248-134680270 TGGCCTGTAGCCGGGCCTGGAGG - Intronic
1062384503 9:136303825-136303847 CGGCATGGCCGCGGGGCTGAGGG + Exonic
1062519036 9:136950050-136950072 CGTGCAGGACGCGGGCCTTGAGG - Intronic
1203781553 EBV:103833-103855 GGGCCTTGACGTGGGCCCGGAGG - Intergenic
1203793147 EBV:162221-162243 AGACCTGGACGCGGCCCTGCAGG - Intergenic
1190385644 X:49879969-49879991 CGGCCCCGGCGCGGCCCTGGGGG + Exonic
1196525479 X:116724421-116724443 TGGCCTGGAGGCGGGCCTGGAGG + Intergenic
1198276308 X:135098310-135098332 CGGCCGGGTCGCGGGCATGAAGG - Intergenic
1198451049 X:136767393-136767415 GCGCCTGGACGCGGGCGAGGAGG + Intronic