ID: 1115474611

View in Genome Browser
Species Human (GRCh38)
Location 14:33800794-33800816
Sequence TCACCTCGGCGGGCGCGTAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 518}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115474611 Original CRISPR TCACCTCGGCGGGCGCGTAG CGG (reversed) Exonic
900899686 1:5508220-5508242 TCACCTGGGCTGGAGTGTAGTGG - Intergenic
901516100 1:9747540-9747562 TCACCTAGGCTGGAGAGTAGTGG + Intronic
901550067 1:9989416-9989438 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
902142328 1:14367187-14367209 TCACCTCGGCTGGAGTGCAGTGG - Intergenic
902337504 1:15762126-15762148 TCACCTCGGCTGGAGTGCAGTGG + Intronic
903413737 1:23167940-23167962 TCACCGCGGCGGGCGGGGGGAGG + Intronic
904504326 1:30938290-30938312 TCACCTAGGCTGGCGTGCAGTGG + Intronic
904685499 1:32257286-32257308 TCGCCTAGGCTGGAGCGTAGTGG + Intronic
905053506 1:35073521-35073543 TCACCTAGGCTGGCGTGAAGTGG - Intronic
905367072 1:37458317-37458339 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
906379733 1:45324950-45324972 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
907768390 1:57435086-57435108 TCACCCAGGCTGGAGCGTAGTGG + Intronic
909069870 1:70981451-70981473 TCACCTAGGCTGGAGCGCAGTGG + Intronic
909342518 1:74547789-74547811 TCACCTGGGCTGGAGTGTAGTGG + Intergenic
909553192 1:76922894-76922916 TCACCTAGGCGGGAGTGTAGTGG - Intronic
911209172 1:95121508-95121530 TCACCCAGGCTGGCGTGTAGTGG + Intronic
912312525 1:108638115-108638137 TCACCTAGGCTGGAGTGTAGTGG + Exonic
912423861 1:109568504-109568526 TCACCCAGGCTGGAGCGTAGTGG - Intronic
912538881 1:110397108-110397130 TCACCCAGGCTGGGGCGTAGTGG - Intergenic
912657361 1:111499049-111499071 TCACCTAGGCTGGAGTGTAGTGG - Intronic
912672200 1:111640922-111640944 TCACCTAGGCTGGAGTGTAGTGG - Intronic
913586357 1:120278856-120278878 TCACCTAGGCTGGAGTGTAGCGG - Intergenic
913621829 1:120619514-120619536 TCACCTAGGCTGGAGTGTAGCGG + Intergenic
914217233 1:145643203-145643225 TCACCTGGGCTGGCGTGCAGTGG + Intronic
914469802 1:147965884-147965906 TCACCTGGGCTGGCGTGCAGTGG + Intronic
914568366 1:148890713-148890735 TCACCTAGGCTGGAGTGTAGCGG - Intronic
914604459 1:149239536-149239558 TCACCTAGGCTGGAGTGTAGCGG + Intergenic
915211066 1:154309959-154309981 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
915559868 1:156680818-156680840 TCACCTGGGCTGGAGTGTAGTGG + Intergenic
915881504 1:159677242-159677264 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
915919542 1:159964018-159964040 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
916992027 1:170254918-170254940 TCACCTCGGCTGGAGTGCAGTGG + Intergenic
917150312 1:171936309-171936331 TCACCTAGGCTGGAGTGTAGTGG - Intronic
917435500 1:175017092-175017114 TCACCTAGGCTGGAGCGTACTGG + Intronic
917632854 1:176906802-176906824 TCACCCAGGCTGGAGCGTAGTGG - Intronic
918286664 1:183062603-183062625 TCACCCAGGCTGGAGCGTAGTGG - Intronic
918483962 1:185010022-185010044 TCACCTGGGCTGGAGTGTAGTGG + Intergenic
918509253 1:185292507-185292529 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
920152988 1:203924415-203924437 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
922244114 1:223777999-223778021 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
922513670 1:226190281-226190303 TCACCTAGGCTGGAGCGCAGTGG - Intergenic
923111089 1:230890637-230890659 TCACCCAGGCTGGCGCGCAGTGG - Intergenic
923377097 1:233374979-233375001 TCACCTGGGCTGGAGTGTAGTGG + Intronic
923493223 1:234502692-234502714 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
923575452 1:235154522-235154544 TCACCTAGGCTGGAGTGTAGTGG - Intronic
924186496 1:241496951-241496973 TCACCTAGGCTGGAGTGTAGGGG + Intergenic
924584188 1:245347350-245347372 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1062785383 10:260479-260501 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
1063554445 10:7064938-7064960 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1063596343 10:7439401-7439423 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1064422072 10:15199008-15199030 TCACTTAGGCGGGAGCGCAGTGG + Intergenic
1064803399 10:19102886-19102908 TCACCTGGGCTGGAGTGTAGTGG + Intronic
1065523656 10:26596210-26596232 TCACCTCGGCTGGAGTGCAGTGG + Intergenic
1066372117 10:34825990-34826012 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1066398549 10:35051273-35051295 TCACCTGGGCGGGAGTGCAGTGG - Intronic
1066422098 10:35273239-35273261 TCACCTAGGCTGGAGCGCAGTGG + Intronic
1067105854 10:43365883-43365905 TCACCTAGGCTGGTGTGTAGTGG - Intergenic
1069017628 10:63448194-63448216 TCACCTAGGCTGGAGTGTAGCGG + Intronic
1069098092 10:64284629-64284651 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1069175159 10:65281202-65281224 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
1070193049 10:74130484-74130506 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1072028535 10:91491874-91491896 TCACCTGGGCTGGAGTGTAGTGG + Intronic
1072201882 10:93167493-93167515 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1072962680 10:99943243-99943265 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1074477802 10:113788495-113788517 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
1075004413 10:118819810-118819832 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1075049907 10:119175816-119175838 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1075692240 10:124405002-124405024 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1076054784 10:127363427-127363449 TCACCTAGGCGGGAGTGCAGTGG - Intronic
1077227070 11:1443112-1443134 TCACCTCGGGGCAGGCGTAGTGG - Exonic
1077397150 11:2330418-2330440 TCGCCCAGGCGGGAGCGTAGTGG - Intergenic
1078320877 11:10333427-10333449 TCACCTCGGCTGGAGTGCAGTGG - Intronic
1079781886 11:24617784-24617806 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1080351475 11:31390354-31390376 TCACCCAGGCTGGCGTGTAGTGG - Intronic
1080665944 11:34336601-34336623 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1081102412 11:39021699-39021721 TCAGCTAGAAGGGCGCGTAGAGG + Intergenic
1083014587 11:59440101-59440123 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1083321803 11:61852298-61852320 TCACCTTGGCTAGAGCGTAGTGG + Intronic
1083548999 11:63571709-63571731 TCACCCCGGCTGGAGTGTAGTGG - Intergenic
1084985641 11:72868649-72868671 TCACCCAGGCGGGAGTGTAGTGG - Intronic
1084991638 11:72931133-72931155 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1085094257 11:73746466-73746488 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1085612543 11:77965101-77965123 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1085736169 11:79041101-79041123 TCACCTTGGCTGGCGTGCAGTGG + Intronic
1085920535 11:80949997-80950019 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1086907706 11:92436156-92436178 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1087996269 11:104813276-104813298 TCACCTGGGCTGGAGCGCAGTGG + Intergenic
1088120333 11:106361455-106361477 TCACCTGGGCTGGAGCGCAGTGG + Intergenic
1088193784 11:107254298-107254320 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1088295986 11:108295364-108295386 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1088777456 11:113099726-113099748 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1088935190 11:114392496-114392518 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1089010415 11:115127623-115127645 TCACCTAGGCGGGAGTGCAGTGG + Intergenic
1089507911 11:118977068-118977090 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1089940873 11:122416119-122416141 TCACCCCGGCTGGAGTGTAGTGG + Intergenic
1090740220 11:129652737-129652759 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1092359552 12:7824691-7824713 TCACCCCGGCTGGAGTGTAGTGG - Intronic
1092640878 12:10507639-10507661 TCACCTAGGCTGGCATGTAGTGG + Intronic
1093464222 12:19433884-19433906 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1094458047 12:30660181-30660203 TCACCTAGGCTGGCGTGCAGTGG - Intronic
1095446928 12:42291634-42291656 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1095465927 12:42487999-42488021 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1096189535 12:49606453-49606475 TCACCTAGGCTGGGGTGTAGTGG - Intronic
1096322454 12:50627371-50627393 TCACCCAGGCGGGAGCGCAGTGG + Intronic
1096416895 12:51422407-51422429 TCACCTCGGCTGGAGTGGAGTGG + Intronic
1096435813 12:51590810-51590832 GCGGCTCGGCGGGGGCGTAGTGG + Intronic
1097205467 12:57317240-57317262 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1098210609 12:68160768-68160790 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1098236363 12:68422086-68422108 TCACCTCGGCTGGAGTGCAGTGG - Intergenic
1098431995 12:70429625-70429647 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1098955837 12:76689022-76689044 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1099429051 12:82559066-82559088 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1099742981 12:86665414-86665436 TCACCTCGGCTGGAGTGCAGTGG + Intronic
1099919879 12:88944095-88944117 TCACCCAGGCTGGAGCGTAGCGG - Intergenic
1099965222 12:89438415-89438437 TCACCCAGGCGGGCGTGCAGTGG - Intronic
1100446660 12:94666869-94666891 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1100596886 12:96079458-96079480 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1100614246 12:96218686-96218708 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1101771831 12:107759213-107759235 TCACCCCAGCTGGCGTGTAGAGG - Intronic
1101958117 12:109228294-109228316 TCACCCAGGCTGGCGTGTAGTGG - Intronic
1102087410 12:110154021-110154043 TCACCTCGGCTGGAGTGCAGTGG + Intronic
1102324898 12:111972033-111972055 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1102443776 12:112985930-112985952 TCACCTAGGCTGGAGCATAGTGG - Intronic
1103001316 12:117387395-117387417 TCACCTAGGCTGGAGCGCAGTGG + Intronic
1103542481 12:121675783-121675805 TCACCCAGGCTGGCGTGTAGTGG + Intergenic
1104194068 12:126514022-126514044 TCACCTCGGCTGGGGTGCAGTGG + Intergenic
1105348436 13:19595103-19595125 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
1105370937 13:19801448-19801470 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1105513273 13:21068966-21068988 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1106177473 13:27343446-27343468 TCACCTAGGCGGGAGTCTAGTGG - Intergenic
1106323966 13:28670068-28670090 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1106608572 13:31254995-31255017 TCACCTGGGCGGGAGTGCAGTGG - Intronic
1106886377 13:34189221-34189243 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
1107465638 13:40647442-40647464 TCACCTAGGCGGGAGTGCAGTGG + Intronic
1107921922 13:45217256-45217278 TCACCTAGGCTGGAGCGTGGCGG - Intronic
1108368673 13:49745397-49745419 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1108688923 13:52845802-52845824 TCACCTCGGCGTGCGCGCCGCGG + Exonic
1108836828 13:54561298-54561320 TCCCCTCGGCTGGAGCGCAGTGG + Intergenic
1109451325 13:62518493-62518515 TCACCTCGGCCGGAGTGCAGTGG - Intergenic
1110170574 13:72495706-72495728 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1110350096 13:74496828-74496850 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1111201048 13:84937538-84937560 TCGCCCCGGCTGGCGCGCAGTGG - Intergenic
1111847445 13:93529553-93529575 TCACCCCGGCTGGAGTGTAGTGG + Intronic
1112061454 13:95743595-95743617 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1113616896 13:111686555-111686577 TCACCTAGGCTGGCGTGCAGTGG - Intergenic
1113622426 13:111771826-111771848 TCACCTAGGCTGGCGTGCAGTGG - Intergenic
1114057574 14:18985862-18985884 TCACCCAGGCTGGAGCGTAGTGG - Intronic
1114469342 14:22948573-22948595 TCACCTCGGCCGGAGTGCAGTGG + Intronic
1114599831 14:23945607-23945629 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
1115474611 14:33800794-33800816 TCACCTCGGCGGGCGCGTAGCGG - Exonic
1115580649 14:34755858-34755880 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1115809525 14:37091392-37091414 TCACCTGGGCTGGAGCGCAGTGG - Intronic
1116373664 14:44169737-44169759 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1116719556 14:48477655-48477677 TCACCCAGGCGGGAGCGCAGTGG + Intergenic
1116881882 14:50178771-50178793 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1117420221 14:55537429-55537451 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1117618171 14:57555269-57555291 TCACCTCGGCTGGAGTGCAGTGG - Intergenic
1117696874 14:58374693-58374715 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1117967102 14:61217370-61217392 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1118208405 14:63744632-63744654 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
1119198987 14:72739200-72739222 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1119292626 14:73507780-73507802 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1119855987 14:77901427-77901449 TCACCCAGGCTGGTGCGTAGTGG + Intronic
1120424626 14:84331306-84331328 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
1120940469 14:89943283-89943305 TCACCTAGGCTGGCGTGCAGTGG + Intronic
1121532677 14:94668366-94668388 TCACCTAGGCTGGAGTGTAGCGG - Intergenic
1121892931 14:97614554-97614576 TCACCCAGGCGGGAGTGTAGTGG + Intergenic
1123005588 14:105321400-105321422 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1123715573 15:23027705-23027727 TCACCCAGGCTGGAGCGTAGTGG - Intronic
1124141740 15:27083370-27083392 TCACCAAGGCTGGCGTGTAGTGG + Intronic
1124578833 15:30933795-30933817 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1124951349 15:34323899-34323921 TCACCTAGGCTGGCGTGCAGTGG - Intronic
1125469500 15:39988959-39988981 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1125580052 15:40778892-40778914 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1126036731 15:44553144-44553166 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1126330601 15:47526774-47526796 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1127209410 15:56757622-56757644 TCACCTGGGCTGGAGTGTAGTGG - Intronic
1127418912 15:58785714-58785736 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1127916979 15:63462826-63462848 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1128037602 15:64540442-64540464 TCACCTCGGCTGGAGTGCAGTGG + Intronic
1128874609 15:71191940-71191962 TCACCTGGGCTGGAGTGTAGTGG + Intronic
1129437826 15:75556415-75556437 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1129695184 15:77736732-77736754 TCACCTAGGCGGGAGTGCAGTGG - Intronic
1130556003 15:84922974-84922996 TCACCTAGGCTGGAGCGCAGTGG + Intronic
1131079854 15:89525764-89525786 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1131145713 15:90010327-90010349 TCACCTCGGCTGGAGTGCAGTGG + Intronic
1131234655 15:90685150-90685172 TCACCCCGGCTGGAGCGCAGTGG + Intergenic
1131287052 15:91068789-91068811 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1133112868 16:3559676-3559698 TCACCTCGGCTGGAGTGCAGTGG + Intronic
1133163144 16:3925640-3925662 TCACCTAGGCTGGCGTGCAGTGG - Intergenic
1133385048 16:5363071-5363093 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
1133790349 16:9004866-9004888 TCACCTGGGCGGGAGTGCAGTGG + Intergenic
1133980561 16:10630273-10630295 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1134071503 16:11262815-11262837 TCACCTCGGCTGGAGTGCAGTGG - Intronic
1134445677 16:14329344-14329366 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1134798050 16:17059632-17059654 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
1135309801 16:21396567-21396589 TCACCTCGGCTGGAGTGCAGTGG - Intergenic
1135573738 16:23568786-23568808 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1135654349 16:24234624-24234646 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1135811202 16:25588271-25588293 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1136306546 16:29375691-29375713 TCACCTCGGCTGGAGTGCAGTGG - Intergenic
1138932288 16:61674412-61674434 TCACCTCGGCTGGAGTGCAGTGG - Intronic
1139049329 16:63104101-63104123 TCACCTGGGCTGGAGTGTAGAGG + Intergenic
1139206317 16:65032448-65032470 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1140536368 16:75713679-75713701 TCACCCCGGCTGGAGTGTAGTGG + Intronic
1140667791 16:77243763-77243785 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1140859893 16:79009505-79009527 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1141056756 16:80823617-80823639 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
1141801966 16:86315806-86315828 TCGCCTGGGCTGGCGTGTAGTGG + Intergenic
1141885113 16:86886104-86886126 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1142288494 16:89181595-89181617 TCACCTAGGCTGGAGCGCAGCGG - Intronic
1144933343 17:18877959-18877981 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1145003660 17:19322698-19322720 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1145020755 17:19428952-19428974 TCACCTAGGCTGGCGTGCAGTGG + Intergenic
1145972621 17:28965597-28965619 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1147797048 17:43051674-43051696 TCACCTAGGCTGGAGCGTAGTGG + Intronic
1148087366 17:45002253-45002275 TCACCCAGGCTGGCGTGTAGTGG - Intergenic
1148091698 17:45026265-45026287 TCACCTAGGCTGGAGCGCAGTGG + Intronic
1148142312 17:45337659-45337681 TCACCCAGGCGGGAGTGTAGTGG + Intergenic
1148869026 17:50644670-50644692 TCACCTCGGCTGGAGTGCAGTGG - Intronic
1148928482 17:51108345-51108367 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1150763580 17:67985536-67985558 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
1151292446 17:73160321-73160343 TCACCCAGGCGGGAGTGTAGTGG + Intergenic
1151748963 17:76026282-76026304 TCACCCAGGCGGGAGCGCAGGGG + Intronic
1151777212 17:76213528-76213550 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1151809123 17:76426040-76426062 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1151851595 17:76693799-76693821 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1151920580 17:77152013-77152035 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1152113618 17:78371379-78371401 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1154154279 18:11931511-11931533 TCACCTGGGCTGGAGTGTAGTGG - Intergenic
1156333010 18:36143133-36143155 TCACCTCGGCTGGAGTGCAGTGG + Intronic
1158163733 18:54515695-54515717 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1161563563 19:4986994-4987016 TCGCCTAGGCTGGAGCGTAGTGG + Intronic
1161603843 19:5203432-5203454 TCACCTGGGCTGGGGTGTAGAGG + Intronic
1161610783 19:5241321-5241343 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1161633511 19:5371665-5371687 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1161736061 19:5992720-5992742 TCACCTCGGCTGGCGTGCAGTGG - Intergenic
1161873575 19:6889950-6889972 TCACCTAGGCTGGAGCGCAGTGG + Intronic
1161969218 19:7567220-7567242 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
1162338620 19:10077791-10077813 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
1162357667 19:10196146-10196168 TCACCCCGGCTGGCGTGCAGTGG + Intronic
1162871979 19:13593130-13593152 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1162987958 19:14283802-14283824 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1163142351 19:15358392-15358414 TCACCTGGGCTGGAGTGTAGTGG + Intronic
1163181196 19:15604006-15604028 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
1163752808 19:19088243-19088265 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1164623388 19:29711077-29711099 TCACCTAGGCTGGAGTGTAGCGG + Intronic
1164913269 19:32029145-32029167 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1165047956 19:33121158-33121180 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1165052416 19:33150407-33150429 TCACCTGGGCTGGAGCGCAGAGG - Intronic
1165411112 19:35662219-35662241 TCACCTAGGCTGGCATGTAGTGG + Intergenic
1165780641 19:38432192-38432214 TCACCTGGGCTGGAGTGTAGTGG + Intergenic
1165804370 19:38571595-38571617 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1165959410 19:39521878-39521900 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
1166027268 19:40098604-40098626 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1166392511 19:42417297-42417319 TCACCTGGGCTGGAGTGTAGTGG + Intronic
1167392161 19:49202629-49202651 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1167819344 19:51911909-51911931 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1167931033 19:52864971-52864993 TCACCCAGGCTGGCGTGTAGTGG - Intronic
1168069078 19:53939216-53939238 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1168377349 19:55891463-55891485 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
1168600398 19:57713475-57713497 TCACCTAGGCTGGAGTGTAGTGG + Intronic
926442235 2:12902025-12902047 TCACCTGGGCTGGAGTGTAGTGG + Intergenic
927163574 2:20293666-20293688 TCACCTAGGCTGGAGTGTAGTGG - Intronic
927282640 2:21323722-21323744 TCACCTCGGCTGGAGTGCAGTGG + Intergenic
927912075 2:26906798-26906820 TCACCCAGGCTGGAGCGTAGTGG + Intronic
928055729 2:28052325-28052347 TCACCCAGGCTGGAGCGTAGTGG + Intronic
928320503 2:30279433-30279455 TCACCTGGGCTGGAGGGTAGTGG + Intronic
928985521 2:37177370-37177392 TCACCTAGGCTGGAGTGTAGCGG - Intronic
929169467 2:38917129-38917151 TCACCTAGGCTGGAGTGTAGTGG + Intronic
930694056 2:54393534-54393556 TCACCTAGGCCGGAGCGCAGTGG + Intergenic
930805153 2:55483076-55483098 TCACCCAGGCGGGAGGGTAGTGG - Intergenic
930912642 2:56647889-56647911 TCACCCAGGCTGGTGCGTAGTGG - Intergenic
931337926 2:61367436-61367458 TCACCTAGGCTGGAGCGCAGTGG - Intronic
931751693 2:65336315-65336337 TCACCTGGGCTGGAGTGTAGTGG - Intronic
932556420 2:72828834-72828856 TCACCTAGGCGGGAGTGCAGTGG - Intergenic
933854977 2:86404183-86404205 CCACCTAGGCTGGAGCGTAGTGG - Intergenic
933907075 2:86905074-86905096 TCACCTAGGCTGGAGCGCAGTGG - Intergenic
933914273 2:86972456-86972478 TCACCTGGGCTGGAGTGTAGTGG + Intronic
933974030 2:87493443-87493465 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
934008720 2:87797443-87797465 TCACCTGGGCTGGAGTGTAGTGG - Intronic
935772366 2:106438446-106438468 TCACCTGGGCTGGAGTGTAGTGG - Intronic
935907706 2:107857470-107857492 TCACCTGGGCTGGAGTGTAGTGG + Intronic
935994103 2:108749629-108749651 TCACCTGGGCTGGAGTGTAGTGG + Intronic
936054565 2:109252206-109252228 TCACCTGGGCTGGAGCGCAGTGG - Intronic
936644382 2:114351769-114351791 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
937707463 2:124937506-124937528 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
938373200 2:130786838-130786860 TCACCTAGGCTGGAGCGCAGTGG - Intergenic
938389001 2:130889770-130889792 TCACCTGGGCTGGCGTGCAGTGG - Intronic
938747484 2:134293506-134293528 TCACCTAGGCTGGAGTGTAGTGG + Intronic
940952110 2:159687000-159687022 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
941046235 2:160678581-160678603 TCACCCAGGCTGGCGTGTAGTGG - Intergenic
941074829 2:160995143-160995165 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
941880179 2:170473180-170473202 TCACCTAGGCTGGAGTGTAGTGG + Intronic
943650194 2:190449432-190449454 TCACCTAGGCGGGTGTGCAGTGG - Intronic
943712093 2:191108249-191108271 TCACCCAGGCTGGAGCGTAGTGG - Intronic
944441750 2:199750316-199750338 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
944545118 2:200791287-200791309 TCACCTAGGCTGGAGCGCAGTGG - Intergenic
944788216 2:203095810-203095832 TCACCTAGGCTGGAGTGTAGTGG + Intronic
944813364 2:203350114-203350136 TCACCTAGGCGGGAGTGCAGTGG + Intronic
947363025 2:229365319-229365341 TGACCTGGGCAGGCCCGTAGAGG - Intronic
947484675 2:230537217-230537239 TCACCTCGGCTGGAGTGCAGTGG - Intronic
947774983 2:232701403-232701425 TCACCTAGGCTGGAGCGCAGCGG - Intronic
1169034989 20:2442694-2442716 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1169076733 20:2764660-2764682 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
1170376882 20:15709625-15709647 TCACCTAGGCGGGAGTGCAGTGG - Intronic
1170961156 20:21027001-21027023 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
1172103704 20:32502547-32502569 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1172258916 20:33544585-33544607 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1172575604 20:36005909-36005931 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1173513323 20:43647592-43647614 TCACCCAGGCGGGAGTGTAGTGG - Intergenic
1174283403 20:49455411-49455433 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1174802729 20:53578070-53578092 TCACCTCGGCTGGAGTGCAGTGG - Intronic
1176291360 21:5046728-5046750 TCACCCCGGCTGGAGTGTAGTGG + Intergenic
1177220768 21:18189672-18189694 TCACCTCGGCTGGAGTGCAGTGG + Intronic
1178082733 21:29081511-29081533 TCACCTGGGCTGGAGCGCAGTGG - Intronic
1179478611 21:41663823-41663845 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1179772831 21:43636147-43636169 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1179865895 21:44216913-44216935 TCACCCCGGCTGGAGTGTAGTGG - Intergenic
1180069177 21:45427585-45427607 GCACCACGGCGGGCGGGGAGCGG + Intronic
1180476063 22:15708472-15708494 TCACCCAGGCTGGAGCGTAGTGG - Intronic
1181929636 22:26390165-26390187 TCACCCAGGCGGGAGTGTAGTGG + Intergenic
1182081397 22:27531579-27531601 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1182231899 22:28844349-28844371 TCACCTAGGCTGGAGAGTAGTGG - Intergenic
1182247128 22:28967884-28967906 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1182248104 22:28976464-28976486 TCACCCAGGCTGGCGTGTAGAGG - Intronic
1182469816 22:30541791-30541813 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1182855396 22:33512761-33512783 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1183559928 22:38564347-38564369 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1183764308 22:39856811-39856833 TCACCCCGGCAGGAGCGCAGTGG - Intronic
1185253566 22:49818844-49818866 TCACCTAGGCTGGAGCGCAGTGG - Intronic
949121153 3:385786-385808 TCACCCAGGCTGGAGCGTAGTGG - Intronic
951230484 3:20172924-20172946 TCACCTCGGCTGGAGGGCAGTGG - Intronic
952353812 3:32566230-32566252 TCACCCAGGCTGGAGCGTAGTGG - Intronic
953314361 3:41912287-41912309 TCACCTAGGCAGGAGTGTAGTGG - Intronic
954011566 3:47644454-47644476 TCACCTAGGCGGGAGTGCAGAGG - Intronic
954190116 3:48953734-48953756 TCACCCCGGCTGGAGCGTAGTGG + Intronic
954261718 3:49443918-49443940 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
954759660 3:52864984-52865006 TCACCTAGGCTGGAGTGTAGTGG + Intronic
955183174 3:56690716-56690738 TCACCCAGGCTGGCGTGTAGTGG - Intergenic
955301294 3:57782510-57782532 TCACCTAGGCTGGAGTGTAGCGG + Intronic
955770350 3:62378745-62378767 AGACCTGGGCGGGGGCGTAGGGG + Intergenic
955912665 3:63873741-63873763 TCACCTAGGCTGGAGCGCAGTGG + Intronic
956144020 3:66174011-66174033 TCACCTAGGCTGGAGCGCAGTGG - Intronic
959517585 3:107286633-107286655 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
959738032 3:109683319-109683341 TCACCTCGGCTGGAGTGCAGTGG - Intergenic
960879900 3:122333469-122333491 TCACCTAGGCTGGAGTGTAGTGG - Intronic
961777061 3:129295395-129295417 TCACCTAGGCTGGAGTGTAGTGG - Intronic
962560402 3:136600569-136600591 TCACCCAGGCTGGCGTGTAGTGG + Intronic
962644894 3:137428470-137428492 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
962780535 3:138711042-138711064 TCACCTCGGCTGGAGTGCAGTGG - Intronic
963006310 3:140728946-140728968 TCACCTAGGCTGGAGCGCAGTGG - Intergenic
963338798 3:144008634-144008656 TCACCCCTGCTGGAGCGTAGTGG - Intronic
964446878 3:156768361-156768383 TCACCTAGGCTGGAGTGTAGCGG - Intergenic
964858982 3:161179585-161179607 TCACCTAGGCTGGAGCGCAGTGG - Intronic
964866967 3:161272763-161272785 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
965642636 3:170846762-170846784 TCACCTAGGCTGGAGTGTAGTGG - Intronic
965667323 3:171109199-171109221 TCACCTAGGCTGGAGCGCAGTGG + Intronic
965805773 3:172539907-172539929 TCACCTAGGCTGGAGAGTAGTGG - Intergenic
967497404 3:190156770-190156792 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
968101089 3:195965916-195965938 TCACCTGGGCTGGAGCGTAATGG + Intergenic
968166134 3:196466758-196466780 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
971165174 4:24175412-24175434 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
971316623 4:25573185-25573207 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
971488457 4:27186604-27186626 TCACCTAGGCTGGCGTGCAGCGG - Intergenic
972335482 4:38104118-38104140 TCACCCAGGCTGGAGCGTAGTGG - Intronic
972422941 4:38906572-38906594 TCACCTAGGCTGGCGTGCAGTGG + Intronic
972691697 4:41404737-41404759 TCACCCAGGCTGGAGCGTAGTGG - Intronic
973659360 4:53087372-53087394 TCACCTAGGCTGGAGTGTAGTGG + Intronic
973923689 4:55715299-55715321 TCACCCCGGCTGGAGCGCAGTGG - Intergenic
975775207 4:77779005-77779027 TCACCTAGGCTGGAGTGTAGTGG - Intronic
978568440 4:110110445-110110467 TCATCTAGGCTGGAGCGTAGTGG + Intronic
979363301 4:119790302-119790324 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
979745442 4:124206743-124206765 TCACCTGGGCGGGAGTGCAGTGG - Intergenic
981640611 4:146939413-146939435 TCACCTAGGCGGGAGTGCAGTGG - Intronic
982826117 4:160005706-160005728 TCACCTGGGCTGGAGTGTAGTGG - Intergenic
983294483 4:165849088-165849110 TCACCTCGGCTGGAGTGCAGTGG + Intergenic
983579818 4:169297076-169297098 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
984874459 4:184354940-184354962 TCACCCCGGCTGGAGTGTAGTGG - Intergenic
986320315 5:6626407-6626429 TCACCTAGGCTGGAGTGTAGTGG + Intronic
986533547 5:8763163-8763185 TCACCCCGGCTGGAGCGCAGTGG + Intergenic
987333756 5:16880138-16880160 TCACCCAGGCTGGAGCGTAGTGG - Intronic
987666655 5:20950886-20950908 TCACCTAGGCTGGAGCATAGTGG + Intergenic
988486113 5:31669360-31669382 TCACCCAGGCTGGAGCGTAGAGG - Intronic
989686489 5:44094333-44094355 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
990964196 5:61427516-61427538 TCACCTAGGCTGGAGTGTAGTGG + Intronic
991927005 5:71715641-71715663 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
992445819 5:76832545-76832567 TCACCCAGGCTGGAGCGTAGTGG - Intronic
992447582 5:76847961-76847983 TCACCTAGGCTGGAGAGTAGTGG + Intergenic
992460661 5:76956682-76956704 TCACCCCGGCTGGAGCGCAGTGG - Intronic
993702421 5:91134225-91134247 TCACCTCGGCTGGAGTGCAGTGG + Intronic
994196616 5:96929543-96929565 GCACCCCGGCGGGAGTGTAGTGG + Intronic
996596950 5:125215443-125215465 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
996741476 5:126803144-126803166 TCACCTAGGCTGGAGCGCAGTGG - Intronic
996887573 5:128375994-128376016 TCACCTAGGCTGGAGTGTAGTGG - Intronic
997332822 5:133078771-133078793 TCACCTAGGCTGGAGTGTAGTGG + Intronic
997491491 5:134280694-134280716 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
997541071 5:134662956-134662978 TCACCTAGGCCGGAGCGCAGTGG - Intronic
998233523 5:140378208-140378230 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
999041603 5:148419700-148419722 TCACCCAGGCTGGAGCGTAGTGG - Intronic
999137928 5:149335446-149335468 TCACCCAGGCGGGAGCGCAGTGG - Intronic
999780086 5:154842235-154842257 TCACCTAGGCTGGAGCGTAGTGG + Intronic
1000685640 5:164245787-164245809 TCACCTAGGCTGGAGCGTAGTGG + Intergenic
1001886008 5:175290929-175290951 TCACCTGGGCTGGAGTGTAGCGG + Intergenic
1001975616 5:175996272-175996294 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1002241814 5:177847500-177847522 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1005042671 6:21613251-21613273 TCACCTAGGCTGGCGTGCAGTGG - Intergenic
1006188511 6:32193458-32193480 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1006566719 6:34965389-34965411 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1007058418 6:38912423-38912445 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1007446694 6:41912086-41912108 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1008820739 6:55628339-55628361 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
1008982064 6:57495781-57495803 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1009328114 6:62379812-62379834 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1009772219 6:68158267-68158289 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1010467763 6:76189120-76189142 TCACCTAGGCTGGCGTGCAGTGG - Intergenic
1011460935 6:87603017-87603039 TCACCCAGGCTGGCGTGTAGTGG + Intronic
1013621236 6:111891688-111891710 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
1014079485 6:117270676-117270698 GCAGCGCGGCGGGCGAGTAGGGG - Exonic
1014778842 6:125540504-125540526 TCACCTTGGCTGGAGTGTAGTGG + Intergenic
1015608563 6:134988321-134988343 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1015735349 6:136393673-136393695 TCACCTCGGCTGGAGTGCAGTGG + Intronic
1015809941 6:137152171-137152193 TCACCTGGGCTGGAGCGCAGTGG - Intronic
1016469001 6:144355245-144355267 TCACCTTGGCTGGAGTGTAGTGG + Intronic
1018607392 6:165612414-165612436 TCACCTAGGCTGGAGCGCAGTGG + Intronic
1019039721 6:169093939-169093961 TCAACTGGGCGGGTGCTTAGGGG - Intergenic
1020064987 7:5181537-5181559 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1022280880 7:28907841-28907863 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1022736623 7:33082018-33082040 TCACCCAGGCTGGAGCGTAGTGG - Intergenic
1023022882 7:36026703-36026725 TCACCTAGGCTGGAGCGCAGTGG - Intergenic
1023949666 7:44833085-44833107 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1024820756 7:53327483-53327505 TCACCTAGGCTGGAGCGTAGTGG + Intergenic
1026210737 7:68302220-68302242 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1026339766 7:69425076-69425098 TCACCTGGGCTGGAGTGTAGTGG + Intergenic
1026617634 7:71920373-71920395 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1028045895 7:86118489-86118511 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1028294543 7:89112064-89112086 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1029081694 7:97979781-97979803 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
1029685490 7:102144629-102144651 TCACCCAGGCTGGAGCGTAGTGG - Intronic
1029706443 7:102278998-102279020 TCACCTGGGCTGGAGTGTAGTGG - Intronic
1029953263 7:104609223-104609245 TCACCTGGGCTGGAGTGTAGTGG - Intronic
1030318868 7:108143769-108143791 TCACCCAGGCGGGAGTGTAGTGG - Intergenic
1032148612 7:129407310-129407332 TCACCCAGGCTGGAGCGTAGTGG - Intronic
1032178629 7:129655559-129655581 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1033169496 7:139071134-139071156 TCACCCAGGCTGGAGCGTAGTGG + Intronic
1033203621 7:139396401-139396423 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1033707238 7:143901863-143901885 TCACCTGGGGGCGCGCGCAGAGG + Intronic
1033708732 7:143916020-143916042 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
1033733495 7:144200422-144200444 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1033749555 7:144350551-144350573 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1033836139 7:145314680-145314702 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
1034851503 7:154498376-154498398 TCACCTAGGCTGGAGCGCAGTGG + Intronic
1035004065 7:155642394-155642416 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1036193667 8:6694871-6694893 TCACCTTGGCTGGAGTGTAGTGG - Intergenic
1037471672 8:19216579-19216601 TCACCTAGGCGGGAGTGCAGTGG - Intergenic
1037581956 8:20250642-20250664 TCACCTAGGCTGGGGTGTAGTGG + Intronic
1037995208 8:23347315-23347337 TCACCTCAGCTGGAGTGTAGTGG - Intronic
1038120910 8:24613772-24613794 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1038445631 8:27602049-27602071 TCACCCAGGCTGGAGCGTAGTGG - Intronic
1038995037 8:32912800-32912822 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1039578204 8:38642748-38642770 TCACCTAGGCTGGAGCGTGGTGG + Intergenic
1039742537 8:40395767-40395789 TCACTTAGGCTGGCGTGTAGGGG - Intergenic
1041043472 8:53869634-53869656 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1041176260 8:55200102-55200124 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1042538958 8:69888281-69888303 TCACCCAGGCGGGAGTGTAGTGG - Intergenic
1042567135 8:70123475-70123497 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1042602069 8:70508554-70508576 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1042942324 8:74120068-74120090 TCACCTGGGCTGGAGTGTAGTGG + Intergenic
1043025697 8:75065315-75065337 TCACCTATGCTGGAGCGTAGTGG - Intergenic
1043038279 8:75226469-75226491 TCACCTAGGTGGGAGTGTAGTGG + Intergenic
1044049003 8:87475901-87475923 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1045026713 8:98094256-98094278 TCACCTAGGCTGGCGTGCAGTGG + Intergenic
1045483174 8:102609271-102609293 TCACCTAGGCTGGAGCGCAGTGG + Intergenic
1045492231 8:102678942-102678964 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1046095841 8:109559416-109559438 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1046758033 8:117991599-117991621 TCACCTAGGCTGGAGCGCAGTGG + Intronic
1047994466 8:130320504-130320526 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1048598994 8:135898658-135898680 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1049739210 8:144227911-144227933 TCACCCAGGCGGGAGCGCAGTGG - Intronic
1049810535 8:144566813-144566835 TCACCTAGGCTGGAGCGCAGTGG - Intronic
1050306578 9:4311367-4311389 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1050507572 9:6363689-6363711 TCACCTAGGCTGGAGCATAGTGG - Intergenic
1051071377 9:13172420-13172442 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1051643834 9:19248835-19248857 TCACCTAGGCTGGAGTGTAGTGG + Intronic
1052157869 9:25216937-25216959 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1052788682 9:32853799-32853821 TCACCTCGGCTGGAGTGCAGTGG - Intergenic
1052949058 9:34193269-34193291 TCACCCAGGCGGGAGCGCAGTGG - Intronic
1052967079 9:34348271-34348293 TCACCTAGGCTGGAGCGGAGTGG + Intergenic
1053166347 9:35846481-35846503 GCACCTCGGCCGTCGCGTTGCGG - Exonic
1053357742 9:37460826-37460848 TCACCTGGGCTGGAGTGTAGTGG - Intronic
1053482282 9:38424465-38424487 ACTGCTCGGCGGGCGCGGAGCGG - Intergenic
1055703786 9:78975471-78975493 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1056327779 9:85494486-85494508 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1056685724 9:88757695-88757717 ACACCTAGGCTGGAGCGTAGGGG + Intergenic
1056930766 9:90874718-90874740 TCTCCTCGGGGTCCGCGTAGGGG - Exonic
1057736257 9:97664137-97664159 TCACCTAGGCGGGAGTGGAGTGG - Intronic
1059147697 9:111916507-111916529 TCACCTAGGCTGGAGCATAGTGG + Intronic
1060298825 9:122361988-122362010 TCACCTCGGCTGGAGTGCAGTGG + Intergenic
1060372195 9:123084962-123084984 TCACCTGGGCAGGCGCGACGTGG - Intronic
1061047146 9:128172106-128172128 TCACCCAGGCTGGAGCGTAGTGG - Intronic
1061070159 9:128304856-128304878 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1061376784 9:130230667-130230689 TCACCTAGGCAGGAGTGTAGTGG - Intronic
1061897651 9:133656855-133656877 TCACCTTGGCGGGTGGGTAATGG - Intronic
1186408955 X:9328979-9329001 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1186468320 X:9801914-9801936 TCACCCAGGCTGGCGTGTAGTGG - Intronic
1186732350 X:12423197-12423219 TCACCCAGGCTGGCGTGTAGTGG - Intronic
1186745125 X:12559608-12559630 TCACCTCGGCTGGAGTGTAATGG - Intronic
1187704444 X:21995601-21995623 TCACCCAGGCTGGAGCGTAGTGG + Intergenic
1187859584 X:23667940-23667962 TCACCTAGGAGGGCGGGGAGGGG + Intronic
1187883868 X:23870749-23870771 TCACCTAGGCTGGAGTGTAGTGG - Intronic
1188669208 X:32862774-32862796 TCACCTTGGCTGGAGTGTAGTGG + Intronic
1188709960 X:33383904-33383926 TCACCTAGGCTGGGGTGTAGTGG + Intergenic
1188894613 X:35651706-35651728 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1189379027 X:40488570-40488592 TCACCTAGGCTGGAGCGTAAAGG + Intergenic
1189385819 X:40536135-40536157 TCACCCCGGCGGGGGCGCAGTGG - Intergenic
1189488933 X:41454644-41454666 TCACCTAGGCTGGAGCGCAGTGG + Intronic
1190096755 X:47487548-47487570 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1190156546 X:47997750-47997772 TCACCCAGGCTGGAGCGTAGTGG - Intronic
1190219917 X:48505211-48505233 TCACCTAGGCTGGAGCGCAGTGG - Intergenic
1190749964 X:53353437-53353459 TCACCCAGGCTGGCGTGTAGTGG - Intergenic
1190761402 X:53440939-53440961 CGACCTTGGCGGGCGCGGAGCGG - Intergenic
1190902086 X:54685688-54685710 TCACCTAGGCTGGCGTGCAGTGG + Intergenic
1195563049 X:106306940-106306962 TCACCTAGGCTGGAGTGTAGTGG + Intergenic
1195649088 X:107266024-107266046 TCACCCAGGCTGGCGCGCAGTGG + Intergenic
1196817469 X:119676729-119676751 TCACCTGGGCGGGAGTGCAGTGG - Intronic
1198457491 X:136831016-136831038 TCACCTAGGCTGGAGTGTAGTGG - Intergenic
1201989118 Y:20005468-20005490 TCACCTAGGCTGGAGTGTAGTGG - Intergenic