ID: 1115475047

View in Genome Browser
Species Human (GRCh38)
Location 14:33805434-33805456
Sequence GCAGCCTTGTGAGCTGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115475043_1115475047 5 Left 1115475043 14:33805406-33805428 CCATAACACTTTGCTTCTGGACA No data
Right 1115475047 14:33805434-33805456 GCAGCCTTGTGAGCTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115475047 Original CRISPR GCAGCCTTGTGAGCTGGAGG TGG Intergenic
No off target data available for this crispr