ID: 1115478664

View in Genome Browser
Species Human (GRCh38)
Location 14:33840623-33840645
Sequence GCTCCATCTTCCCACCTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115478656_1115478664 23 Left 1115478656 14:33840577-33840599 CCCTCCTCATCAGACAAAGGCCA No data
Right 1115478664 14:33840623-33840645 GCTCCATCTTCCCACCTTCTTGG No data
1115478662_1115478664 -6 Left 1115478662 14:33840606-33840628 CCATCTGCAGCCTGGAGGCTCCA No data
Right 1115478664 14:33840623-33840645 GCTCCATCTTCCCACCTTCTTGG No data
1115478659_1115478664 3 Left 1115478659 14:33840597-33840619 CCAGTTCTTCCATCTGCAGCCTG No data
Right 1115478664 14:33840623-33840645 GCTCCATCTTCCCACCTTCTTGG No data
1115478657_1115478664 22 Left 1115478657 14:33840578-33840600 CCTCCTCATCAGACAAAGGCCAG No data
Right 1115478664 14:33840623-33840645 GCTCCATCTTCCCACCTTCTTGG No data
1115478658_1115478664 19 Left 1115478658 14:33840581-33840603 CCTCATCAGACAAAGGCCAGTTC No data
Right 1115478664 14:33840623-33840645 GCTCCATCTTCCCACCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115478664 Original CRISPR GCTCCATCTTCCCACCTTCT TGG Intergenic
No off target data available for this crispr