ID: 1115479017

View in Genome Browser
Species Human (GRCh38)
Location 14:33843781-33843803
Sequence CTCAAATAGATTACGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115479017_1115479024 1 Left 1115479017 14:33843781-33843803 CCTTTTCCCGTAATCTATTTGAG No data
Right 1115479024 14:33843805-33843827 AAGATGGTTCCGAGCTGGGAAGG No data
1115479017_1115479028 10 Left 1115479017 14:33843781-33843803 CCTTTTCCCGTAATCTATTTGAG No data
Right 1115479028 14:33843814-33843836 CCGAGCTGGGAAGGGGCTGCAGG No data
1115479017_1115479025 2 Left 1115479017 14:33843781-33843803 CCTTTTCCCGTAATCTATTTGAG No data
Right 1115479025 14:33843806-33843828 AGATGGTTCCGAGCTGGGAAGGG No data
1115479017_1115479030 14 Left 1115479017 14:33843781-33843803 CCTTTTCCCGTAATCTATTTGAG No data
Right 1115479030 14:33843818-33843840 GCTGGGAAGGGGCTGCAGGTGGG No data
1115479017_1115479022 -4 Left 1115479017 14:33843781-33843803 CCTTTTCCCGTAATCTATTTGAG No data
Right 1115479022 14:33843800-33843822 TGAGGAAGATGGTTCCGAGCTGG No data
1115479017_1115479029 13 Left 1115479017 14:33843781-33843803 CCTTTTCCCGTAATCTATTTGAG No data
Right 1115479029 14:33843817-33843839 AGCTGGGAAGGGGCTGCAGGTGG No data
1115479017_1115479023 -3 Left 1115479017 14:33843781-33843803 CCTTTTCCCGTAATCTATTTGAG No data
Right 1115479023 14:33843801-33843823 GAGGAAGATGGTTCCGAGCTGGG No data
1115479017_1115479026 3 Left 1115479017 14:33843781-33843803 CCTTTTCCCGTAATCTATTTGAG No data
Right 1115479026 14:33843807-33843829 GATGGTTCCGAGCTGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115479017 Original CRISPR CTCAAATAGATTACGGGAAA AGG (reversed) Intergenic
No off target data available for this crispr