ID: 1115484996

View in Genome Browser
Species Human (GRCh38)
Location 14:33901767-33901789
Sequence CAGGGAAGGCCTATAGCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115484986_1115484996 2 Left 1115484986 14:33901742-33901764 CCCCAGTGAAGCCTCACCTTCAA 0: 4
1: 45
2: 172
3: 339
4: 651
Right 1115484996 14:33901767-33901789 CAGGGAAGGCCTATAGCCTAGGG No data
1115484988_1115484996 0 Left 1115484988 14:33901744-33901766 CCAGTGAAGCCTCACCTTCAAGC 0: 4
1: 55
2: 203
3: 329
4: 471
Right 1115484996 14:33901767-33901789 CAGGGAAGGCCTATAGCCTAGGG No data
1115484991_1115484996 -9 Left 1115484991 14:33901753-33901775 CCTCACCTTCAAGCCAGGGAAGG No data
Right 1115484996 14:33901767-33901789 CAGGGAAGGCCTATAGCCTAGGG No data
1115484987_1115484996 1 Left 1115484987 14:33901743-33901765 CCCAGTGAAGCCTCACCTTCAAG 0: 3
1: 57
2: 230
3: 443
4: 773
Right 1115484996 14:33901767-33901789 CAGGGAAGGCCTATAGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115484996 Original CRISPR CAGGGAAGGCCTATAGCCTA GGG Intergenic
No off target data available for this crispr