ID: 1115485972

View in Genome Browser
Species Human (GRCh38)
Location 14:33911641-33911663
Sequence CAGCACCAATAAATGAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115485972_1115485977 5 Left 1115485972 14:33911641-33911663 CCATGTCTCATTTATTGGTGCTG No data
Right 1115485977 14:33911669-33911691 CTTCTTTGGCCTCTTAAACTTGG No data
1115485972_1115485979 23 Left 1115485972 14:33911641-33911663 CCATGTCTCATTTATTGGTGCTG No data
Right 1115485979 14:33911687-33911709 CTTGGTGCCTTCTCTTATTGAGG No data
1115485972_1115485976 -9 Left 1115485972 14:33911641-33911663 CCATGTCTCATTTATTGGTGCTG No data
Right 1115485976 14:33911655-33911677 TTGGTGCTGGGGTTCTTCTTTGG No data
1115485972_1115485981 30 Left 1115485972 14:33911641-33911663 CCATGTCTCATTTATTGGTGCTG No data
Right 1115485981 14:33911694-33911716 CCTTCTCTTATTGAGGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115485972 Original CRISPR CAGCACCAATAAATGAGACA TGG (reversed) Intergenic
No off target data available for this crispr