ID: 1115490408

View in Genome Browser
Species Human (GRCh38)
Location 14:33952761-33952783
Sequence CAGTGATGGCCTTTACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115490408_1115490410 7 Left 1115490408 14:33952761-33952783 CCTTGGGGTAAAGGCCATCACTG 0: 1
1: 0
2: 0
3: 21
4: 116
Right 1115490410 14:33952791-33952813 AGCTCTTGTCTAAATTCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 157
1115490408_1115490413 25 Left 1115490408 14:33952761-33952783 CCTTGGGGTAAAGGCCATCACTG 0: 1
1: 0
2: 0
3: 21
4: 116
Right 1115490413 14:33952809-33952831 CAAGGCAGCTCCATGATGAGAGG 0: 1
1: 0
2: 0
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115490408 Original CRISPR CAGTGATGGCCTTTACCCCA AGG (reversed) Intronic
904384728 1:30133786-30133808 CGGTCAGGGCCTTTGCCCCAGGG - Intergenic
905123481 1:35700855-35700877 CAATGATGTCCTTTACAACAGGG + Intergenic
905497437 1:38403678-38403700 CAGGGATGGTCTTTACCTGATGG - Intergenic
907327128 1:53645620-53645642 CCATGTTGGCCTGTACCCCAAGG - Intronic
907502618 1:54893400-54893422 TTGTGATGGCCTTTAGTCCAAGG + Intergenic
909556658 1:76961435-76961457 CATTGATGGGCTTTATCCAAGGG - Intronic
910520595 1:88117719-88117741 AAGTGATGGCCTTGACACCCTGG - Intergenic
913346508 1:117816126-117816148 CAGTGATGACACTTACCCCAGGG + Intergenic
914225238 1:145714559-145714581 CACTGCTGGCCTTTAGCCCAGGG - Intergenic
914410149 1:147419624-147419646 CAGTGGTGGCCCTCACCACATGG - Intergenic
917282041 1:173386578-173386600 CTGTGATGGCCCCAACCCCATGG - Intergenic
918100228 1:181366284-181366306 CTGTGATGGCCTTTGGTCCATGG + Intergenic
920409169 1:205745207-205745229 CAGTGATGACTTTGAACCCAAGG - Intronic
920914308 1:210247743-210247765 CAGTTATGGTCATTAGCCCAAGG + Intergenic
1062910908 10:1211666-1211688 CAGTGATGGTGCTTACACCATGG - Intronic
1065033651 10:21614410-21614432 AAGTGATGGTATTTAGCCCATGG - Intronic
1069669886 10:70193382-70193404 CAGTTATTTCCTTTACTCCATGG + Intergenic
1077523073 11:3047767-3047789 CAGGGCTGGCCTTTGCCACAGGG + Exonic
1078975167 11:16465912-16465934 AAGAGATGGTCTCTACCCCAAGG - Intronic
1080585163 11:33675207-33675229 CTGCAATGGCCTTCACCCCACGG - Intergenic
1080703606 11:34667434-34667456 CAGTTATGCCCTTTAACACAGGG - Intergenic
1086340919 11:85847232-85847254 CAGTGATGGCCCTGAGCTCAGGG - Intergenic
1088719525 11:112579670-112579692 CAGAGAAGGCCATTTCCCCATGG + Intergenic
1092200945 12:6582386-6582408 CAGTGGTGGGCTTTACCTCAAGG - Intronic
1094664090 12:32500996-32501018 CACTGATGGTGTTTACCACAGGG - Intronic
1096548918 12:52359578-52359600 CAGTCATGGACTCCACCCCAAGG - Intergenic
1098664379 12:73142548-73142570 CATTCATGGCCTTTACCATAGGG - Intergenic
1101740751 12:107498030-107498052 CAGTGCTGCCCTCCACCCCAGGG - Intronic
1102377073 12:112431157-112431179 CAGTGATGGGGCTTACCCCAAGG + Intronic
1104078088 12:125408030-125408052 CAGTGACTGCCTCTACCACAGGG + Intronic
1105777637 13:23678051-23678073 CAGTGAGGGGCTTTGCACCAGGG - Intergenic
1107011153 13:35672936-35672958 CAATGAGGGCCGTTTCCCCATGG - Intronic
1107978117 13:45709359-45709381 CCATGATGGCTTTTAACCCATGG - Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108588607 13:51892691-51892713 CCATGATGGCCTTTCCCCCATGG + Intergenic
1113075316 13:106462261-106462283 CAGTGATGCCATTGACCCCATGG - Intergenic
1115311611 14:31984465-31984487 CAGCCATGGCCTTTCCCCAAGGG - Intergenic
1115490408 14:33952761-33952783 CAGTGATGGCCTTTACCCCAAGG - Intronic
1118503776 14:66388881-66388903 CAGTGATGGCCATAAGGCCAGGG + Intergenic
1121863257 14:97339067-97339089 CAGTCATGGCCTCTTCTCCAGGG + Intergenic
1123773099 15:23548846-23548868 CAGTGTTTGCCTTTACCTCCAGG + Intergenic
1133041178 16:3060398-3060420 CACCGATGGCCTGAACCCCATGG + Exonic
1135307778 16:21381738-21381760 CAGTGCTGGGATTTACCCCCAGG + Intergenic
1135423890 16:22322847-22322869 CAGTGACATCCTATACCCCAAGG + Exonic
1136304522 16:29360858-29360880 CAGTGCTGGGATTTACCCCCAGG + Intergenic
1141982829 16:87560743-87560765 CAGTTATGGCCCCAACCCCAGGG - Intergenic
1141996158 16:87637666-87637688 CAGTGGTGGCTGTTATCCCAGGG - Intronic
1143029592 17:3960382-3960404 CAGTGAGCGCCTTGGCCCCAGGG - Intronic
1143867484 17:9934591-9934613 CAGTGAGGGCCTTGACCCCTGGG + Intronic
1146299647 17:31678194-31678216 CAGTTATTCCCTTAACCCCATGG + Intergenic
1146690717 17:34873880-34873902 CAGTGGTGGACATTTCCCCAGGG - Intergenic
1148029632 17:44610519-44610541 CAGTTCTGGCCATTTCCCCATGG + Intergenic
1149685981 17:58535069-58535091 CAGTGATAGCCTTTGGTCCAAGG - Intronic
1150602435 17:66662393-66662415 CAGTGATGGCTTTAGCGCCATGG + Intronic
1151132220 17:71908921-71908943 CTGTCATAGCATTTACCCCAGGG + Intergenic
1153041513 18:816673-816695 CAGTCATGGCTTTTAGACCATGG + Intergenic
1153147456 18:2050039-2050061 CAGTGATGGCCTCTGACCTAAGG + Intergenic
1153989641 18:10385071-10385093 CTGTGATGGCCTTCACCCCCTGG + Intergenic
1155730909 18:29157023-29157045 CATTGAAGCCCTTTACCCCAGGG + Intergenic
1156068122 18:33170553-33170575 CAGTGATAGGATTTACCCCACGG - Intronic
1156317515 18:35984203-35984225 CTGTGAGGGCCGTAACCCCAGGG + Intergenic
1157442272 18:47720001-47720023 CAGTGAGGGTATTTACACCATGG - Intergenic
1159838110 18:73365210-73365232 CTGTAATGACCTTCACCCCACGG - Intergenic
1162302409 19:9851233-9851255 CAGTAATACCGTTTACCCCAAGG - Intergenic
1163686992 19:18717380-18717402 CAGGGATGCCCTTGACCCCAAGG - Intronic
1168026034 19:53644231-53644253 CAGTGATCGCCCATCCCCCAAGG - Intergenic
930338762 2:50084447-50084469 CAGTGATGGGCTTAGCACCAGGG - Intronic
937276256 2:120685975-120685997 CAGTGATGGCGTTGACCTCATGG - Intergenic
937310789 2:120902130-120902152 CAGTGAGAGCATTTACACCATGG + Intronic
939331373 2:140766101-140766123 CATTAATGACATTTACCCCAGGG - Intronic
944418747 2:199505780-199505802 AAGTGACTTCCTTTACCCCATGG + Intergenic
945489166 2:210434710-210434732 CAGTGATGGCCTCGTCCCTAAGG + Intronic
947701716 2:232240008-232240030 CAGTGATGTCTTCCACCCCATGG + Intronic
1170966066 20:21072630-21072652 CAGTGATGGGCTTTAAAGCAAGG + Intergenic
1171726127 20:28622569-28622591 CAGTGCTGCCCTTTGACCCAGGG + Intergenic
1171752003 20:29060807-29060829 CAGTGCTGCCCTTTGACCCAGGG - Intergenic
1173255173 20:41389471-41389493 CAGTTATTGCCTCTACCTCAGGG + Intergenic
1175448785 20:59044949-59044971 TAGTTATGGCCCTTGCCCCAGGG + Intergenic
1176130306 20:63493975-63493997 CTGTGATGGCGTTTTCCTCATGG - Intronic
1178405120 21:32317275-32317297 CAGTAATGGCTTCTACCTCATGG - Intronic
1180391032 22:12282177-12282199 CAGTGCTGCCCTTTGACCCAGGG + Intergenic
1180408710 22:12582580-12582602 CAGTGCTGCCCTTTGACCCAGGG - Intergenic
1185326746 22:50229384-50229406 CAGGTATGGCCTTTGCCTCATGG - Exonic
950516763 3:13471568-13471590 CAGAGGTGACATTTACCCCAAGG + Intergenic
950897950 3:16470381-16470403 CTCTGATGGCTTTTAGCCCAAGG + Intronic
961155477 3:124676042-124676064 CTTTGAGGGCCTTTATCCCAAGG - Intronic
967874790 3:194260573-194260595 CACTCATGGCCTTGACCTCATGG - Intergenic
969016693 4:4108087-4108109 CAGGCATGGCCTTCACCCCGTGG + Intergenic
970036576 4:11742272-11742294 CAGTGAGGGCTTTCACCCCAGGG - Intergenic
972185068 4:36518797-36518819 GTGTGATGGCCTTTGCTCCAGGG - Intergenic
974070235 4:57116426-57116448 CAGTGAGGGACTTTACCTCAAGG - Intergenic
975847658 4:78541847-78541869 TAGTGATGCCCTTCACCCCAGGG + Intronic
984375325 4:178922281-178922303 CAGGGATGGCCTGAAGCCCAGGG + Intergenic
986950635 5:13080446-13080468 CAGAGATGGCCTGAAGCCCAGGG + Intergenic
990715387 5:58630836-58630858 CAGTGTTGGCATTTATCACAAGG + Intronic
991436459 5:66601365-66601387 CAGAGATGGTTTTGACCCCAGGG + Intronic
997420314 5:133761768-133761790 TAATGATGGCATTTAACCCATGG + Intergenic
999993983 5:157074505-157074527 CATTCATGGCCTCTATCCCAGGG - Intergenic
1001246448 5:170108572-170108594 CAGTGGTGTCCTCTACCCCAGGG + Exonic
1001583683 5:172818283-172818305 CAGTGGTGGCCTTTGCACCAGGG + Intergenic
1002656372 5:180751385-180751407 CAGTGATCTCCCTTTCCCCAAGG - Intergenic
1004651613 6:17615052-17615074 TATTGATGGCATTTATCCCATGG + Exonic
1006562446 6:34925425-34925447 CATTGAAGGCCTTTGCCCCAAGG - Intronic
1008563524 6:52745058-52745080 CTTTGATGGCCATTAGCCCATGG - Intergenic
1014775960 6:125510329-125510351 CAGTAATGGCCTTCACTTCAGGG - Intergenic
1017845489 6:158254509-158254531 GAGTGTTGGCCTTTTCTCCAAGG + Intronic
1018359051 6:163046584-163046606 CAGTGATGGCTTTGAACCCGGGG + Intronic
1023074976 7:36473501-36473523 CAGTAATGACTTTTACTCCAGGG + Intergenic
1023747102 7:43331717-43331739 CAGTGATGGCGTCCACCTCATGG - Intronic
1025088235 7:56040937-56040959 GAGAGATGCCCTTTACCCCTTGG - Intronic
1028420593 7:90628387-90628409 CAGTAATGGCCTTTAACACTTGG - Intronic
1029230543 7:99064377-99064399 CAGTGATGGCCTCTAGGCCTGGG + Intronic
1030747078 7:113179520-113179542 CAGGGATGGACTTTACCCTCTGG - Intergenic
1033989384 7:147265267-147265289 CAGTGATGGCTGCTGCCCCATGG - Intronic
1038779629 8:30558744-30558766 CTGTGAGGGCCTCTTCCCCAAGG - Intronic
1040952885 8:52953936-52953958 CAGTGATGGGCTTAACACCTGGG + Intergenic
1043175519 8:77019525-77019547 CAGACATGGCCTCTACTCCAAGG - Intergenic
1044866018 8:96572030-96572052 CACTGATGGCCTTTAACAGAAGG - Intronic
1048361368 8:133699883-133699905 CAGTGGTGCCCTCTAGCCCAGGG - Intergenic
1048521594 8:135160386-135160408 CACTGATGGCCTTTATTCCCAGG - Intergenic
1048820667 8:138377825-138377847 CAGTGATGTCCTTCTCCCCAGGG + Intronic
1051343303 9:16130474-16130496 CAGAGATGGTGTTTCCCCCATGG + Intergenic
1055844016 9:80539376-80539398 GAGAGATGTCCTTTACACCAAGG + Intergenic
1056693129 9:88824769-88824791 CAAGGATGGCCTTTCCTCCACGG - Intergenic
1057036833 9:91817421-91817443 CAGAGATGGTCTCTACCTCAAGG + Intronic
1057862643 9:98653809-98653831 CAGTGCTGACCTTTAGCTCATGG + Intronic
1059486722 9:114632919-114632941 CAGAGCTGGGCTTTATCCCAGGG + Intronic
1061895978 9:133647939-133647961 CAGTGATGGCCATTCCACCACGG + Exonic
1062272610 9:135716773-135716795 CACAGATGCCCTGTACCCCATGG - Intronic
1062515670 9:136933999-136934021 CAGGGGTGGCCTTATCCCCAAGG - Intronic
1186806311 X:13143505-13143527 CAGGGATGGCCCTTCACCCAGGG + Intergenic
1189221324 X:39374831-39374853 CAGTGACTTCCTTTTCCCCATGG - Intergenic
1190290584 X:48989564-48989586 CAGTCCTGGCCCCTACCCCAGGG + Intronic
1195924977 X:110015996-110016018 CAGGGGTGGCCTTTAGGCCAAGG + Intronic
1196894564 X:120322087-120322109 CAGTGAAGGCCTTGAAGCCAGGG - Intergenic
1199612304 X:149628976-149628998 CAGTCACGGCCTTGACCCCATGG + Intronic
1200226584 X:154420866-154420888 CAGGGATGGCCTGCACCCCTCGG - Intronic
1200373024 X:155747712-155747734 CAGAGTTGGCCTTTAAGCCAAGG - Intergenic