ID: 1115490952

View in Genome Browser
Species Human (GRCh38)
Location 14:33957607-33957629
Sequence ATATATGAACAGAAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 342}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115490952_1115490960 28 Left 1115490952 14:33957607-33957629 CCTCTCTGCTTCTGTTCATATAT 0: 1
1: 0
2: 3
3: 33
4: 342
Right 1115490960 14:33957658-33957680 ACCTGATTGCTCTAAGGCAGTGG 0: 1
1: 0
2: 2
3: 12
4: 138
1115490952_1115490962 29 Left 1115490952 14:33957607-33957629 CCTCTCTGCTTCTGTTCATATAT 0: 1
1: 0
2: 3
3: 33
4: 342
Right 1115490962 14:33957659-33957681 CCTGATTGCTCTAAGGCAGTGGG 0: 1
1: 0
2: 1
3: 4
4: 106
1115490952_1115490959 22 Left 1115490952 14:33957607-33957629 CCTCTCTGCTTCTGTTCATATAT 0: 1
1: 0
2: 3
3: 33
4: 342
Right 1115490959 14:33957652-33957674 GAAAGAACCTGATTGCTCTAAGG 0: 1
1: 0
2: 0
3: 6
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115490952 Original CRISPR ATATATGAACAGAAGCAGAG AGG (reversed) Intronic
900464531 1:2818612-2818634 ACATATGCACACATGCAGAGAGG - Intergenic
902696873 1:18146062-18146084 ATATGTAAACAGGATCAGAGAGG - Intronic
905120325 1:35676899-35676921 ATAGATGAACAGAAGAGGATTGG + Intergenic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
907355246 1:53867256-53867278 ATATATGAACATTTGCAGTGTGG - Intronic
907932262 1:59011526-59011548 ATGTGTGGAAAGAAGCAGAGAGG + Intergenic
911308550 1:96262676-96262698 ATATAACAACAGTAGCATAGGGG + Intergenic
911407138 1:97456385-97456407 ATAAGCCAACAGAAGCAGAGAGG - Intronic
912100964 1:106204044-106204066 ATAAATAAATAGAAGCAGAATGG + Intergenic
913578486 1:120201361-120201383 ATATAATGACAAAAGCAGAGGGG - Intergenic
913629686 1:120696990-120697012 ATATAATGACAAAAGCAGAGGGG + Intergenic
914413323 1:147453790-147453812 ATAAATAAACTGAAGCACAGAGG - Intergenic
914560410 1:148812801-148812823 ATATAATGACAAAAGCAGAGGGG - Intronic
914612423 1:149317414-149317436 ATATAATGACAAAAGCAGAGGGG + Intergenic
916259878 1:162831066-162831088 GAATAAAAACAGAAGCAGAGTGG + Intronic
916260454 1:162836726-162836748 CAATCTGAACAGAAGCAGAAAGG - Intronic
916345108 1:163779970-163779992 AGATAGGAACAGAAGAAAAGAGG + Intergenic
917183621 1:172326443-172326465 AAATATGTACAGAAACAGGGAGG + Intronic
917214244 1:172661422-172661444 CCATATGTACACAAGCAGAGTGG + Intronic
917385704 1:174471805-174471827 ATATATGAACGCCAGGAGAGGGG - Intronic
918266910 1:182851241-182851263 ATATATTGGCAGAAGCAAAGTGG + Intronic
918574316 1:186037823-186037845 ATATGTGAAAAAAAGAAGAGAGG + Intronic
918613685 1:186520524-186520546 ATATATAAACATAAGCACACAGG - Intergenic
921369962 1:214412128-214412150 ATATATGAAAAGATGCAGATGGG - Intronic
921475010 1:215596233-215596255 ACATAGGAAGAGAAGCAGAGAGG + Intronic
921973691 1:221178073-221178095 AAATAGGAAGAGAAGAAGAGAGG + Intergenic
923787630 1:237083510-237083532 ATACACCAACACAAGCAGAGAGG - Intronic
924282762 1:242454557-242454579 ATATATGAAAAGAGACACAGGGG + Intronic
924890936 1:248279427-248279449 TTATATAACCTGAAGCAGAGTGG - Intergenic
924931100 1:248733101-248733123 CTAAAGGAACAGAAGCTGAGAGG + Intronic
1062811541 10:470114-470136 ATATGTAGACAGATGCAGAGAGG + Intronic
1063398274 10:5714577-5714599 ACATAAGAAGAGAAGCAGATTGG + Intronic
1063594362 10:7420356-7420378 ACAGATGAACATTAGCAGAGAGG + Intergenic
1063649818 10:7923196-7923218 GTATGTGAACAGAAATAGAGCGG + Intronic
1066446660 10:35490432-35490454 ATTTATGATCAGAAGCACAAAGG - Intronic
1069204551 10:65665313-65665335 AAATATGAAGAAAAGCAAAGAGG - Intergenic
1071699600 10:87916039-87916061 GTAGATAAACAAAAGCAGAGAGG - Intronic
1072301719 10:94068159-94068181 TTAGGTGAACAAAAGCAGAGTGG - Intronic
1072865234 10:99052851-99052873 CCATATGAACAAATGCAGAGAGG + Intronic
1073194422 10:101677040-101677062 ATATATGAACAAATACAAAGAGG - Intronic
1074172496 10:110956467-110956489 CTATATCCAAAGAAGCAGAGTGG - Intronic
1074212484 10:111349624-111349646 TTATGTGAAGAGAAGCAGTGTGG + Intergenic
1074271627 10:111959319-111959341 ATGTTTGAACAAAAACAGAGAGG + Intergenic
1074333214 10:112541316-112541338 ATATAAGAACACATGCAGAGAGG - Intronic
1075310488 10:121409836-121409858 CCATGTGAACAGAAGCATAGAGG - Intergenic
1075974755 10:126685694-126685716 ATATGGGTACTGAAGCAGAGGGG + Intergenic
1077941334 11:6846694-6846716 ATATGTGAAGAGAGGCAGAGAGG - Exonic
1078779040 11:14419980-14420002 AGGCATGAACAGAGGCAGAGAGG + Intergenic
1078786672 11:14500870-14500892 ATGAATGCACAGAATCAGAGAGG - Intergenic
1079049797 11:17144179-17144201 GTATATAAACAAAAGCAGATAGG - Intronic
1079854760 11:25588656-25588678 CGCTATGATCAGAAGCAGAGTGG - Intergenic
1080229502 11:30003072-30003094 AGATAGGAACAGGAGCAGGGAGG - Intergenic
1080347457 11:31340845-31340867 ATATATGAAGAGAGAGAGAGAGG - Intronic
1081231924 11:40595853-40595875 ATTTCTCAATAGAAGCAGAGTGG + Intronic
1081841810 11:46207667-46207689 ACAGATGAACATTAGCAGAGAGG + Intergenic
1082617115 11:55374261-55374283 ATATATGAACATATGCAGATTGG - Intergenic
1082622963 11:55446425-55446447 ATCTATGAACATATGCAGACTGG - Intergenic
1082965648 11:58964004-58964026 ATGCAAGTACAGAAGCAGAGCGG + Intronic
1084481265 11:69421619-69421641 ATTTAAGAAAATAAGCAGAGTGG - Intergenic
1084918290 11:72448088-72448110 ATCTATCAACATGAGCAGAGTGG - Intergenic
1085560184 11:77465323-77465345 ATAAATGAACAGAAGTTAAGTGG - Intronic
1085845564 11:80060710-80060732 ACATATGAACAGAAGCAGGAGGG + Intergenic
1086474307 11:87154482-87154504 ATATATACCCAGAAGCAGGGTGG + Intronic
1086907771 11:92436628-92436650 ATATTTGCACATAAGAAGAGTGG - Intronic
1088567261 11:111185022-111185044 ATATGTGAATATAAACAGAGTGG + Intergenic
1088895456 11:114074861-114074883 ACATATGACAAGAACCAGAGAGG - Intronic
1090019411 11:123114119-123114141 AGATTCGAACAGAGGCAGAGGGG + Intronic
1090220094 11:125012677-125012699 ATATATAAACAGAATCAAGGTGG + Intronic
1090549761 11:127806909-127806931 ATATTTGAACATAAACAGACAGG - Intergenic
1091156511 11:133379315-133379337 ATAAATGATCAGACGCACAGGGG - Intronic
1091415902 12:284041-284063 CTATATGAACAAAAGCAAAATGG + Exonic
1091443805 12:531652-531674 AAATAAGAAAAGAAGCATAGAGG + Intronic
1091761683 12:3091658-3091680 AAATAAGAACAAAGGCAGAGTGG + Intronic
1091941475 12:4487510-4487532 AGATAGGAGCAGAAGCAGAATGG - Intergenic
1093012163 12:14118837-14118859 ATATAAGAAAAGAGGCTGAGTGG + Intergenic
1093163453 12:15777329-15777351 ATATATGACCAAAACCACAGTGG + Intronic
1093185074 12:16010613-16010635 GTTTATGAACAGAAGGAGAGAGG + Intronic
1094469630 12:30791690-30791712 ATATAAAAACAGAATTAGAGAGG - Intergenic
1095757467 12:45785106-45785128 ATATAAGAAAATAAGAAGAGAGG - Intronic
1095758859 12:45804002-45804024 ATATATGAAGAGAGGGAGAGAGG + Intronic
1096333383 12:50734275-50734297 ATATATGAACAAAAGGAATGAGG - Intronic
1097796865 12:63871920-63871942 TGCTATGATCAGAAGCAGAGTGG - Intronic
1098048465 12:66427173-66427195 ATTTAAGTAAAGAAGCAGAGGGG - Intronic
1098089653 12:66887754-66887776 ATATACTAAAAGAAACAGAGAGG + Intergenic
1098720530 12:73892000-73892022 AACTAAGAATAGAAGCAGAGAGG - Intergenic
1098752872 12:74317843-74317865 ATATATGAACAAAAGAAGAGAGG - Intergenic
1099218645 12:79884655-79884677 ATATAAGGAAAGAAGCAGAACGG + Intronic
1099495149 12:83338444-83338466 ATCTATGAATAGAAGAAAAGGGG + Intergenic
1099721750 12:86370975-86370997 CTATATGTATAGGAGCAGAGAGG + Intronic
1100036025 12:90253097-90253119 ATATGAGAACAGAATAAGAGGGG + Intergenic
1101485603 12:105155458-105155480 CTATCTGAACAGTAGCAGAGGGG + Intronic
1103217579 12:119214162-119214184 ATATTTGAACTCAGGCAGAGTGG - Intronic
1103217606 12:119214391-119214413 ATATTTGAACTCAGGCAGAGTGG - Intronic
1104417988 12:128611336-128611358 ATAAATGAAATGAAGAAGAGAGG - Intronic
1106082362 13:26511023-26511045 ATATGTGGACACAAGCACAGAGG + Intergenic
1106100456 13:26690892-26690914 ATTGATGAACAGATGGAGAGGGG - Intergenic
1106420316 13:29580377-29580399 ATAAATGTAGAAAAGCAGAGAGG - Intronic
1106720311 13:32428741-32428763 ATTTATGAACAGTAGCATAAGGG + Intergenic
1107000679 13:35541137-35541159 ATATATTGTAAGAAGCAGAGAGG - Intronic
1107161003 13:37227624-37227646 ATATATGAGCAGAAGTGAAGGGG + Intergenic
1107706575 13:43113234-43113256 ATATATTGAAAGGAGCAGAGAGG + Exonic
1107949640 13:45450507-45450529 AAATATTTACAGAAGGAGAGTGG + Intergenic
1108668719 13:52659728-52659750 ATATATGAAAAGTATCACAGTGG + Intronic
1109100113 13:58173105-58173127 ATATATGAACAGAGGTAAAATGG - Intergenic
1111089306 13:83421994-83422016 AAATATGTACAGAAAGAGAGAGG + Intergenic
1111403877 13:87776829-87776851 TAATATGAACAAAAGCAGATGGG - Intergenic
1111404681 13:87787985-87788007 ATAAATGAAATGAAGCAGAGGGG - Intergenic
1111791928 13:92868248-92868270 AGAAATGGACAAAAGCAGAGTGG + Intronic
1112261530 13:97882198-97882220 ATAGATGAACAGAAGAGCAGAGG - Intergenic
1112263142 13:97896722-97896744 ATATATGAACAAAACCAAAAAGG + Intergenic
1112849858 13:103692203-103692225 ATATATTAACATAAGCAGACTGG + Intergenic
1113782509 13:112984859-112984881 AGGGATGGACAGAAGCAGAGCGG - Intronic
1114799555 14:25757868-25757890 AAATATGAAGAGAAGGTGAGAGG - Intergenic
1115490952 14:33957607-33957629 ATATATGAACAGAAGCAGAGAGG - Intronic
1116334166 14:43635910-43635932 ATATATAAAAATAAGAAGAGAGG + Intergenic
1116774833 14:49167395-49167417 ATAAATGAACAAAAGCGCAGTGG + Intergenic
1117544960 14:56785823-56785845 AGATAAGGACAGGAGCAGAGTGG - Intergenic
1118565310 14:67134027-67134049 ACATATAAACTGAAGCATAGAGG - Intronic
1119213288 14:72849150-72849172 ACACAGGAAGAGAAGCAGAGTGG - Intronic
1119464790 14:74848358-74848380 ATAAATGAAAAGAACCAGAAAGG + Intronic
1120012327 14:79430817-79430839 ATGTAAGAACAGCAGAAGAGGGG - Intronic
1120102241 14:80458583-80458605 ATGTCTGAACAGATGAAGAGGGG - Intergenic
1120682627 14:87498955-87498977 AGAGATGGACAGAGGCAGAGAGG + Intergenic
1121585876 14:95062472-95062494 ATAAAGAAACAGCAGCAGAGGGG - Intergenic
1121669468 14:95696815-95696837 AGATATGGACAGGAGGAGAGAGG + Intergenic
1123632172 15:22269015-22269037 ATTTCTGATCAGAAGCAAAGTGG - Intergenic
1123814537 15:23963057-23963079 ATATACGAACAAAATCAAAGTGG - Intergenic
1124440298 15:29681043-29681065 ACAGATGAACATTAGCAGAGAGG - Intergenic
1125133462 15:36312360-36312382 ATATATGAACAGAAGTATGTTGG + Intergenic
1125295821 15:38202201-38202223 ATATATGACCAGAAACCTAGAGG + Intergenic
1125794615 15:42395059-42395081 ATATAAGTACAGGAGCCGAGGGG - Intronic
1127270622 15:57398251-57398273 ATATGTAAATAAAAGCAGAGGGG - Intronic
1128409312 15:67378159-67378181 ATTTGTGAACAGGGGCAGAGTGG + Intronic
1128550120 15:68592632-68592654 ATATATGAATAGATGCAGAGAGG - Intronic
1130090592 15:80817640-80817662 ATATGTAAGTAGAAGCAGAGAGG + Intronic
1130834520 15:87636166-87636188 AGATATGAGCAGCAGCACAGTGG + Intergenic
1131451757 15:92547057-92547079 ATTTATGAAGAAAAACAGAGAGG + Intergenic
1132621938 16:871879-871901 AGAGATGAACAGCAGGAGAGGGG + Intronic
1133099900 16:3472881-3472903 TTATATTAACAGATGCACAGTGG - Intronic
1133321949 16:4919623-4919645 ATACATGAACATAACTAGAGAGG - Intronic
1135642292 16:24131254-24131276 ATCTAAAATCAGAAGCAGAGAGG + Intronic
1135661142 16:24297700-24297722 ATCTAAGAACAGAAGCATAAGGG + Intronic
1137788321 16:51154496-51154518 CAATAAAAACAGAAGCAGAGTGG + Intergenic
1137963003 16:52903590-52903612 ATATATGAACAGATGAGGATAGG - Intergenic
1138159436 16:54739609-54739631 ATATATAAACAGATACAGATAGG - Intergenic
1138178138 16:54921924-54921946 CTATATTAACAGAATTAGAGGGG - Intergenic
1140916513 16:79498632-79498654 ATATAGGAACAGAAACAGAGAGG + Intergenic
1140951249 16:79819858-79819880 ATGTCTTAAGAGAAGCAGAGTGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143964254 17:10745347-10745369 ATGTGTGGACAGAAGCAGGGGGG - Intergenic
1143975997 17:10830233-10830255 ATCTATAAACAGAAGCAGGCAGG + Intronic
1146520045 17:33519268-33519290 TTATACAAATAGAAGCAGAGCGG + Intronic
1147165589 17:38591520-38591542 CTTTAGTAACAGAAGCAGAGAGG - Intronic
1148322584 17:46766540-46766562 GTATCTGAACAAAAGCAGTGTGG - Intronic
1148638759 17:49169291-49169313 ATATGGGCACAGAGGCAGAGTGG - Intronic
1149106688 17:52975780-52975802 ATATGTGAATAGATGCAGTGTGG - Intergenic
1149495962 17:57117692-57117714 TTAGATGGACAGAAGCAGAGAGG - Intronic
1149541119 17:57468897-57468919 TTATAAGAACAAAAGCAGAAGGG - Intronic
1149793362 17:59498485-59498507 ATATCTGAAGAGAAGCAGGGTGG + Intergenic
1151171052 17:72246632-72246654 TTATAAGAACAGAAGAAGACAGG - Intergenic
1151752556 17:76048538-76048560 ATGAAGGAACGGAAGCAGAGGGG + Intronic
1152859068 17:82685174-82685196 ATATCTCAATAAAAGCAGAGAGG + Intronic
1153134107 18:1893983-1894005 ATGAATGAAAAGAAGCAGGGCGG - Intergenic
1153318005 18:3743296-3743318 ATATATGAATAGAAGGACTGAGG - Intronic
1153372907 18:4340199-4340221 TTATATGAACACAAGCACTGTGG + Intronic
1153459168 18:5314722-5314744 ACATCTGGTCAGAAGCAGAGAGG + Intergenic
1156276618 18:35589498-35589520 AAACATTAACAGAAGCAGAAGGG - Intronic
1158619286 18:59017524-59017546 ATATAAAAACAGAAGGAGGGTGG - Intergenic
1158619398 18:59018778-59018800 ATATAGAAACAGAGGGAGAGTGG + Intergenic
1158768709 18:60488138-60488160 ATATATTAATAGAAACAGAAAGG - Intergenic
1158961234 18:62589165-62589187 ATTTCTGAACAGAAGTATAGAGG + Intergenic
1159073267 18:63649402-63649424 ATATATAGAGAGAAGGAGAGAGG - Intronic
1159685400 18:71412837-71412859 ATACATGAATAGAAGCAGGGAGG - Intergenic
1160108840 18:76005958-76005980 AGTTATGAAGAGAAGAAGAGGGG - Intergenic
1162062843 19:8107263-8107285 ATAAATGGACAGAAGGAGGGGGG + Intronic
1162265126 19:9566748-9566770 CTCTATGAACAGAAGCAATGTGG - Exonic
1162633779 19:11950017-11950039 ATACATGAAAGGAAGCACAGAGG + Exonic
1163375314 19:16926798-16926820 AGATAGGAGAAGAAGCAGAGAGG - Intronic
1163856974 19:19710714-19710736 ATATATGAAAGGAGTCAGAGTGG - Exonic
1165585198 19:36909206-36909228 ATCTAGGAACAGAAGAAGTGAGG + Intronic
1166267514 19:41694438-41694460 TTCTCTGAACAGAAACAGAGGGG + Intronic
1166895561 19:46019906-46019928 TTATATAGACAGAATCAGAGCGG + Intronic
1167451542 19:49573107-49573129 ATAAATGAAGAGAGGCACAGAGG + Intronic
1167707702 19:51091398-51091420 ACATGAGATCAGAAGCAGAGAGG - Intergenic
1167890766 19:52537358-52537380 AGATATGTACAGAATTAGAGAGG + Intronic
1167958781 19:53089772-53089794 AGATATGTACAGAATGAGAGAGG - Intronic
1168302055 19:55410738-55410760 ACTTATGAACAGAAACAGGGAGG + Intergenic
925518713 2:4715780-4715802 CTATTTGAAAAGAAACAGAGAGG + Intergenic
925877426 2:8324879-8324901 ATACATGCAAAGAAGTAGAGAGG - Intergenic
928201995 2:29253427-29253449 ACATATTAAAAGAAGCAAAGGGG + Intronic
930466208 2:51753396-51753418 ATATTTGAACCTAAGCAGTGTGG - Intergenic
931865843 2:66410288-66410310 ATAAACGAAAGGAAGCAGAGAGG + Intergenic
933504999 2:83165575-83165597 GTATGTGCACAAAAGCAGAGGGG - Intergenic
935002404 2:99031935-99031957 ATAGATTAACATTAGCAGAGAGG + Intronic
935203177 2:100876153-100876175 AGAGAGGAACAGAACCAGAGAGG - Intronic
936466541 2:112756780-112756802 ATATCTTAACAGAACCTGAGAGG - Exonic
937068510 2:119041192-119041214 ATAAATGCACAGGATCAGAGGGG - Intergenic
938657104 2:133445754-133445776 ATAGGTGAACAGAGGCACAGAGG + Intronic
939078782 2:137634915-137634937 AAACAAAAACAGAAGCAGAGAGG - Intronic
939491751 2:142884936-142884958 ATATATGAAAAGAAGAAAATAGG + Intronic
939491790 2:142885163-142885185 ATATATGAAAAGAAGAAAATAGG - Intronic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
942845838 2:180424156-180424178 ATATATGAAAAAAAGGAAAGTGG - Intergenic
942926017 2:181433474-181433496 ATACATGAACAGAAATAGGGGGG + Intergenic
943395143 2:187324362-187324384 TTATAGGTCCAGAAGCAGAGAGG + Intergenic
944434310 2:199670872-199670894 ATAGAAGGACAGAAGAAGAGGGG - Intergenic
945668932 2:212778887-212778909 ATAAATTAAGAGAAGTAGAGAGG - Intergenic
946097831 2:217290988-217291010 ATATATGAACCGAATCTGGGAGG + Intronic
948905003 2:240975604-240975626 ATATCTGAACAGGAGCAGAAGGG - Intronic
1169719055 20:8652679-8652701 ATATATTACCAGAAACACAGTGG + Intronic
1169845498 20:9987438-9987460 GTTTATGCACAGAAGTAGAGAGG + Intronic
1170385700 20:15814081-15814103 AAATAGGAAGAGAAGAAGAGAGG + Intronic
1170689146 20:18596445-18596467 AAATGTGAACAGAAGAAGGGAGG - Intronic
1170823123 20:19771058-19771080 ACAGATGAAGAGAAGCACAGGGG + Intergenic
1170940880 20:20846860-20846882 ATATATAGACAGCAGCAGTGTGG - Intergenic
1174102080 20:48135360-48135382 GGTTATGAACAGAAGCAGAATGG + Intergenic
1175234911 20:57503123-57503145 ATAGATGACCACAAGCTGAGTGG - Intronic
1182846163 22:33432838-33432860 ATATTTGAAAGGAAGCAGTGAGG - Intronic
1183052351 22:35273854-35273876 ATAAAGGAACAGAGGCAGAGAGG - Intronic
1183101736 22:35588429-35588451 AAAAATGAACAGGAGCAGGGTGG - Intergenic
1183334690 22:37239950-37239972 ATATAAGGACAGGACCAGAGAGG + Intronic
1183559012 22:38555159-38555181 ATATATGAACATTAACAGATGGG - Intronic
1184457645 22:44620721-44620743 ATGGATGAACAGGAGCAGAATGG + Intergenic
1185153770 22:49181276-49181298 ATATATGGATATACGCAGAGAGG - Intergenic
949405440 3:3709131-3709153 ATATATGAAAAGAAGAAAAGTGG - Intronic
949914747 3:8950794-8950816 AGATGGGAACATAAGCAGAGAGG + Intronic
950830814 3:15874120-15874142 ATATATTAACAAAAGGAGATAGG - Intergenic
951677396 3:25257733-25257755 ATAGATGAAGAGAAGTTGAGTGG - Intronic
951787149 3:26434729-26434751 ATATATGAATAGAGTCAGGGAGG + Intergenic
952658284 3:35814244-35814266 ATATAAAAACTGAAGGAGAGAGG + Intergenic
953127588 3:40106600-40106622 AAATAAGAACAGAAGGAAAGTGG - Intronic
954473354 3:50719242-50719264 ATATCTAAACTGAAACAGAGAGG - Intronic
955408762 3:58642539-58642561 TTCTAAGAACAGAGGCAGAGAGG + Intronic
955441994 3:58966259-58966281 TTCTAAGAACAGAGGCAGAGAGG + Intronic
955718152 3:61852978-61853000 TTAGATGAACAGATGCAAAGAGG - Intronic
955834606 3:63041068-63041090 ATGTAGGAAGAGAATCAGAGGGG + Intergenic
955941829 3:64153333-64153355 ATGAATGCACAGAAGCTGAGGGG - Exonic
958124942 3:89343662-89343684 ATATGAGACCAGAAGCAAAGTGG - Intronic
961511115 3:127404365-127404387 ATTCATGAACATTAGCAGAGAGG - Intergenic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
965281171 3:166754794-166754816 ATATATGACAAGGAGCATAGAGG - Intergenic
965331666 3:167381799-167381821 ATATTTTAACAGGAGCAGAAAGG + Intergenic
966292207 3:178372891-178372913 ATATAGTAAAAGAAACAGAGTGG - Intergenic
966780778 3:183582230-183582252 ATATATATACATAAGCAGAAAGG + Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968909419 4:3469923-3469945 AAACATGAACAGAAGCCGAGAGG - Intronic
968935287 4:3607109-3607131 ATAAATAAGCAGAAGCAGAGAGG - Intergenic
969112851 4:4854490-4854512 ATGAAAGAACAGAATCAGAGAGG - Intergenic
971313811 4:25550057-25550079 AGAGAGGAACAGAAACAGAGAGG - Intergenic
971322834 4:25619127-25619149 ATATATGGACACAAGAAGAAAGG + Intergenic
972297200 4:37751351-37751373 ATTCAGGACCAGAAGCAGAGAGG - Intergenic
973680874 4:53318014-53318036 ATATATGTACACAAGTAGTGGGG - Intronic
974028750 4:56757112-56757134 ATCTAAGATGAGAAGCAGAGAGG + Intergenic
974374658 4:61060990-61061012 ATATATGATCAGAAGTTGGGAGG - Intergenic
975283329 4:72588539-72588561 ATATATGAGTAAAAGCAGAAAGG - Intergenic
975478743 4:74854242-74854264 AGCCATGAACAGGAGCAGAGGGG - Intergenic
975681061 4:76876569-76876591 AAAGTTGAAAAGAAGCAGAGGGG + Intergenic
977978509 4:103295467-103295489 ATATAAGAACTGGAGCACAGAGG + Intergenic
978577238 4:110199248-110199270 ATTAATGAACAGAGGCAGAGTGG + Intergenic
978860436 4:113442455-113442477 AGATTTGGACAGAAACAGAGAGG - Intergenic
982352964 4:154436011-154436033 ATTTAGCAAAAGAAGCAGAGAGG - Intronic
982882522 4:160737899-160737921 ATAAAGAAACAGAAGCAGACTGG - Intergenic
983254593 4:165383623-165383645 ATATTTTAACAGATTCAGAGAGG - Intronic
983609419 4:169626223-169626245 ACAGATGAACAGATGCATAGGGG + Intronic
984364288 4:178778165-178778187 ATATATGATCTGAACAAGAGAGG + Intergenic
984370079 4:178852658-178852680 ACATATGAATAGAGACAGAGTGG - Intergenic
985218055 4:187674061-187674083 ATAGAAGAATAGAAGCAAAGGGG + Intergenic
987742100 5:21922980-21923002 ATATATGGAGAGAAGGAGAGAGG + Intronic
988176895 5:27739514-27739536 ATGTATGAACATAAGAAGAGAGG + Intergenic
988800070 5:34688412-34688434 ATATATGAACAGGGGCCCAGAGG + Intronic
988821682 5:34892736-34892758 TTGCATGAACAGAAGCATAGTGG + Intronic
992153537 5:73930851-73930873 ATATTGGAACAGAAGTACAGAGG - Intronic
993418517 5:87668701-87668723 GTATATTATCAGAAACAGAGAGG + Intergenic
993502204 5:88676688-88676710 TTAAATAAACAGAAGCAGGGAGG - Intergenic
993585168 5:89715712-89715734 ATATATGAAAAGAAACACAATGG + Intergenic
993962346 5:94314873-94314895 ATGTAAGAACAGAAGCTGAAGGG - Intronic
994474653 5:100251249-100251271 ATATTTAGACAGAAGCAGTGGGG - Intergenic
994553728 5:101270147-101270169 CTATATCAACAAAAGCAGTGTGG + Intergenic
994871233 5:105352077-105352099 TTATAGGAACAGGAGCAGAGTGG + Intergenic
995039816 5:107574735-107574757 ATCTATTGACAGAAGCAGTGGGG + Intronic
995802294 5:116010932-116010954 AAATATGAAAAGAAGAAGAGAGG - Intronic
996072432 5:119148620-119148642 AAATATGAACAAAATCAAAGGGG - Intronic
996405740 5:123100406-123100428 AGAAAGGAACAGAAGCATAGAGG + Intronic
997748175 5:136318117-136318139 GTACATGAATGGAAGCAGAGAGG + Intronic
999479921 5:151938597-151938619 AAAGATGAAGAGATGCAGAGGGG + Intergenic
999520677 5:152347796-152347818 ATATATAAACTAAAGCAGACTGG + Intergenic
1000043957 5:157506108-157506130 ATATATGTTCAGAAGAAGAATGG - Intronic
1000666718 5:164006804-164006826 ATTTATAAACAGAAGGAAAGAGG + Intergenic
1001425768 5:171621322-171621344 ATATATGAACAGATGGAAGGTGG + Intergenic
1003448171 6:6204492-6204514 ATGTATTAGCAGAACCAGAGAGG - Intronic
1003683687 6:8280169-8280191 AAATAAAAACAGAAACAGAGTGG + Intergenic
1003705865 6:8528259-8528281 CTATATGCACAGAAAGAGAGTGG + Intergenic
1004344489 6:14836065-14836087 ATATATGAAGAAAAATAGAGAGG + Intergenic
1005427250 6:25715788-25715810 ATATATGAGTGGAAGCAGAGAGG + Intergenic
1006912889 6:37575589-37575611 ATATGACAACAGAAGCACAGAGG - Intergenic
1010397227 6:75406327-75406349 CAACATGAACAGAATCAGAGTGG - Intronic
1010733353 6:79413776-79413798 AAATAAGAACAGATTCAGAGTGG - Intergenic
1010910552 6:81549937-81549959 ATCTATGAAAATAATCAGAGTGG - Intronic
1012563553 6:100617590-100617612 ACATGTGAACAGAAGCAGTTTGG - Intronic
1013887052 6:114980686-114980708 TTATATGAGCAGAAACACAGTGG + Intergenic
1014962276 6:127702101-127702123 ATAGATGAACAAAAACAGAGGGG - Intergenic
1017898681 6:158702637-158702659 ATGTTCGAATAGAAGCAGAGCGG + Intronic
1018831361 6:167446111-167446133 AGCGTTGAACAGAAGCAGAGGGG - Intergenic
1019020932 6:168917058-168917080 AAACATGAACTGATGCAGAGTGG - Intergenic
1022307461 7:29160723-29160745 ACATATGCACTGAGGCAGAGAGG + Intronic
1022351868 7:29573721-29573743 ATATATAAACAGAACTTGAGTGG + Intergenic
1022637640 7:32152237-32152259 ACAACTGAACAGCAGCAGAGCGG - Intronic
1023274618 7:38504702-38504724 ATATCTATATAGAAGCAGAGAGG + Intronic
1023574253 7:41608675-41608697 ATATATAGACAGAAGAACAGAGG - Intergenic
1024779020 7:52824132-52824154 AAATATGAAAACAAGCAAAGTGG + Intergenic
1026501459 7:70946537-70946559 AAAGATGAACAGAAGCTGACGGG - Intergenic
1027418688 7:77998867-77998889 GTTTATGCACAGAAGCAAAGAGG + Intergenic
1027785212 7:82572199-82572221 ATATTTGTATAGAAGCAGTGAGG + Intergenic
1028127468 7:87130215-87130237 ATAAATGAACTGAAGAAGAAGGG + Intergenic
1028498726 7:91492938-91492960 ATCTGTGAACATAAACAGAGTGG + Intergenic
1028660499 7:93267234-93267256 CTAGAGTAACAGAAGCAGAGAGG - Intronic
1030153473 7:106428409-106428431 ATATTTGAACAGAAGTTGGGTGG - Intergenic
1032096096 7:128939116-128939138 ATAAGTGACCAGAACCAGAGAGG + Intronic
1032875964 7:136038461-136038483 ATCTAGTAATAGAAGCAGAGAGG + Intergenic
1032894414 7:136234898-136234920 AAAAAAGAACTGAAGCAGAGAGG + Intergenic
1033767291 7:144507455-144507477 ATACATGAGCAAGAGCAGAGTGG - Intronic
1034295819 7:149971595-149971617 GTATATAAACAGAAGCAGGTAGG + Intergenic
1034732915 7:153403515-153403537 ATATTTGGAGAGAAGGAGAGGGG - Intergenic
1034810233 7:154125309-154125331 GTATATAAACAGAAGCAGGTAGG - Intronic
1035332028 7:158102628-158102650 ATATATGGAGAGAGGCAGAAGGG + Intronic
1035411355 7:158645308-158645330 ATATAAAAACAGATGCAGGGTGG + Intronic
1037330100 8:17735903-17735925 ATAAATGCAAAGCAGCAGAGAGG + Intronic
1037419993 8:18691898-18691920 TTATTTGAACAGAGACAGAGAGG + Intronic
1037695976 8:21224276-21224298 ATCTGTGAACAGAAACAGAATGG + Intergenic
1039574894 8:38615264-38615286 ATACATGAACAGAAGTATAGTGG + Intergenic
1041373379 8:57188467-57188489 ATATATAAATAGATGCTGAGGGG + Intergenic
1042312111 8:67389232-67389254 ATATGTGAACTGAAGCAAAGAGG + Intergenic
1043021625 8:75008644-75008666 ATATAAGTGCTGAAGCAGAGGGG - Intronic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044614639 8:94127138-94127160 AAATAAAAACAGAGGCAGAGCGG + Intergenic
1045398898 8:101791425-101791447 ATATAAAAACAGAAGCTCAGGGG + Intronic
1045435129 8:102155259-102155281 ATATATGAAAAAAAGCAAAAAGG + Intergenic
1045558301 8:103236388-103236410 TTATTTTAACAGATGCAGAGAGG - Intergenic
1045910244 8:107399134-107399156 ATATTTGCACAGGAGAAGAGGGG + Intronic
1046055556 8:109074162-109074184 AAATATGAAGAAAAGCAGCGAGG - Intergenic
1046922514 8:119747790-119747812 ACAAATGAACAGAAGAAAAGTGG + Intronic
1047798930 8:128288670-128288692 ATATATGCAAAGAAACAGAGGGG - Intergenic
1049123690 8:140766002-140766024 TTATATGAAAGGAAGCAGTGAGG - Intronic
1050546216 9:6711446-6711468 CTTTATGATCAAAAGCAGAGTGG - Intergenic
1050908235 9:11032426-11032448 ATATATGGAGAGAATCAGAGAGG - Intergenic
1051130832 9:13858527-13858549 ATGTAAGAAAGGAAGCAGAGGGG - Intergenic
1051586245 9:18729991-18730013 ATCAATCAACAGTAGCAGAGTGG + Intronic
1051960477 9:22755541-22755563 ATATAGGAACTGAAGCATAGAGG - Intergenic
1052210468 9:25896943-25896965 AAATATGAACAGAAGGACTGAGG - Intergenic
1052347273 9:27422432-27422454 CTATATCAACAGAATTAGAGAGG - Intronic
1053224547 9:36341920-36341942 ATATATGAACAAAAGCACAAAGG - Intronic
1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG + Intergenic
1055035882 9:71818008-71818030 ATATATGGAAAGAAAGAGAGGGG - Intergenic
1055892499 9:81138340-81138362 ATTAATGTACAGAACCAGAGAGG - Intergenic
1057442783 9:95094094-95094116 ATAAATGAAAGGAAACAGAGAGG - Intergenic
1057454579 9:95196716-95196738 AAATGTGAACCGAAGCAGACAGG - Intronic
1059645781 9:116265480-116265502 AAATATAAACAAAAGCACAGAGG - Intronic
1061719207 9:132541397-132541419 ATCTTTGAACCAAAGCAGAGAGG - Intronic
1203790202 EBV:147325-147347 AAATATGTACAGAACCAAAGAGG - Intergenic
1185815354 X:3150089-3150111 ATAAATAAACAGAAGAGGAGAGG - Intergenic
1186693241 X:12002277-12002299 CTACATGAACAGAAGCAGGCCGG - Intergenic
1188043066 X:25393040-25393062 ACCTGTGGACAGAAGCAGAGAGG - Intergenic
1190194517 X:48305661-48305683 ACACATTAACAGAAGCGGAGTGG + Intergenic
1190661020 X:52654274-52654296 ACACATTAACAGAAGCGGAGTGG + Intronic
1191031520 X:55978889-55978911 ATATATCTACAGAGGCAAAGAGG + Intergenic
1192613551 X:72592835-72592857 AACTATGGCCAGAAGCAGAGAGG + Intronic
1192700188 X:73460795-73460817 TTCTTTGAACAGAAGAAGAGCGG - Intergenic
1192944555 X:75951106-75951128 ATTTATGAACAGAAAAAGAAAGG + Intergenic
1193764758 X:85513682-85513704 AGACATGAACAGAAGTTGAGTGG + Intergenic
1194432822 X:93831690-93831712 ATTTATCAACATATGCAGAGTGG - Intergenic
1195282739 X:103352474-103352496 ATGTATGAATAGAAACAGAAAGG - Intergenic
1196073681 X:111551397-111551419 AGATAAGAGTAGAAGCAGAGAGG - Intergenic
1197574733 X:128198203-128198225 ATATATTAACAGAGACATAGAGG + Intergenic
1197634490 X:128899735-128899757 ATATATGTAGATAAGCAGTGAGG - Intergenic
1197841371 X:130750891-130750913 AGATATGGATAGAAACAGAGAGG - Intronic
1197885439 X:131212968-131212990 ATATATGCACAGAAACACATAGG + Intergenic
1199834915 X:151580068-151580090 ATACAGAAACAGAAGCACAGAGG - Intronic
1201674218 Y:16560966-16560988 TCAAATGTACAGAAGCAGAGAGG + Intergenic
1202082760 Y:21101722-21101744 AAATAAGAACAGAAGTTGAGTGG + Intergenic