ID: 1115493160

View in Genome Browser
Species Human (GRCh38)
Location 14:33978410-33978432
Sequence GAAGCCAATTTTGAGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115493160_1115493162 -2 Left 1115493160 14:33978410-33978432 CCCATCAACTCAAAATTGGCTTC 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1115493162 14:33978431-33978453 TCTGTATATCCCCATTTCTTTGG 0: 1
1: 0
2: 6
3: 41
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115493160 Original CRISPR GAAGCCAATTTTGAGTTGAT GGG (reversed) Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909683225 1:78316042-78316064 ATAGCCAATGATGAGTTGATGGG + Intronic
912786368 1:112607650-112607672 GAATACAATTTGGGGTTGATTGG + Intronic
916724084 1:167507387-167507409 GAAGACAGTATTGAGTTGCTGGG - Intronic
917029744 1:170676637-170676659 AAAGCCAATTTTAAGAAGATAGG + Intronic
921451013 1:215305617-215305639 GAAGCCAGGTGTGAGTTTATGGG - Intergenic
921708785 1:218352748-218352770 GAAGGCAATTTAGAGATGGTAGG - Intronic
922887257 1:229029488-229029510 GCAGACATTTTTGTGTTGATGGG - Intergenic
1063992294 10:11579203-11579225 AAAACCAATTTTGAGTTGACAGG + Intronic
1065717521 10:28586857-28586879 TATGCCAATTTTGATTTGCTGGG + Intronic
1067243247 10:44514795-44514817 TAATGCAATTTTGAGGTGATGGG - Intergenic
1068255970 10:54511320-54511342 GAAGCCAAATTAGAGTCCATGGG - Intronic
1073893062 10:108122967-108122989 GAACCCAAGTTTGATTTTATGGG + Intergenic
1074963232 10:118466506-118466528 TTAGCCAACTTTGAGTTGTTGGG - Intergenic
1076814371 10:132907632-132907654 GAAGGGAATTTTGAGGGGATAGG - Intronic
1079289485 11:19174420-19174442 GAAGGCTATGTGGAGTTGATGGG - Intronic
1082883665 11:58062344-58062366 TGAGCCACTTTTTAGTTGATTGG + Intronic
1083927486 11:65817210-65817232 GATGCAAATTGTGAGTAGATAGG - Intergenic
1085025398 11:73233506-73233528 GCAGGTAATTTTGAGTTCATGGG - Intronic
1085933673 11:81118092-81118114 GCAACTAATGTTGAGTTGATAGG + Intergenic
1086009662 11:82085365-82085387 GAAGCCAATTAAGAGTTGTAGGG + Intergenic
1087260177 11:96002403-96002425 GAAGCCAATGTTGTTTTTATGGG + Intronic
1089314434 11:117581918-117581940 GAAGTGAATTTTGAGGAGATAGG - Intronic
1090101534 11:123802613-123802635 GAAGCCAATCTGGAAATGATGGG - Intergenic
1090372592 11:126267156-126267178 GAAGGCAAGTTTGAGTTCTTTGG - Exonic
1091888363 12:4032514-4032536 GCAGCAAATTATGAGTTGACCGG + Intergenic
1094759899 12:33520632-33520654 GAAGACAACTTAGAGTTCATGGG - Intergenic
1095534977 12:43234657-43234679 GAAGCCAGTTTGGATCTGATTGG + Intergenic
1098937165 12:76493245-76493267 GAAGCAAATTTTGATTGGTTTGG - Intronic
1099948186 12:89269333-89269355 GAAGCTGATTTTGAGTACATTGG + Intergenic
1101197545 12:102400410-102400432 GATACCAATTTTCAGTTGAATGG + Intronic
1102587822 12:113935408-113935430 GAAGAGAATTTTGTTTTGATGGG + Intronic
1113194667 13:107788177-107788199 TAAGCTAATTTTGGGATGATAGG - Intronic
1113398343 13:109969401-109969423 GAAGCCAGGTTTGAGTAGCTTGG + Intergenic
1115493160 14:33978410-33978432 GAAGCCAATTTTGAGTTGATGGG - Intronic
1120425994 14:84349234-84349256 GATGCCTTTTATGAGTTGATGGG + Intergenic
1126920384 15:53515288-53515310 AAAGACAATTTTGAGTTTCTGGG + Exonic
1130020088 15:80222519-80222541 GAAAACAATTTTGAGATAATTGG - Intergenic
1130713057 15:86302930-86302952 GAAGGCAATTATGAGCTAATAGG + Intronic
1131969657 15:97878940-97878962 GAAGCAACATTAGAGTTGATTGG - Intergenic
1134362818 16:13547905-13547927 GAAAACAATTTTGAGCTGAAAGG + Intergenic
1138661169 16:58518038-58518060 GAAGACAATTCTGAGGTGAAAGG - Exonic
1139222480 16:65197953-65197975 GAAGGGAATTTTCAGTAGATGGG - Intergenic
1139843554 16:69902280-69902302 GATGGCAATTGTGAGTGGATTGG + Intronic
1139934307 16:70557347-70557369 GAAGCCAATTATGAACTGAGAGG - Intronic
1144247288 17:13379615-13379637 GAAGCCAAATATCAGTTGATTGG + Intergenic
1144449134 17:15360700-15360722 AAAGTAAATTTTGAGTTAATGGG + Intergenic
1144795214 17:17886713-17886735 CAAGCCAAATTTGAGATAATAGG + Intronic
1148277954 17:46322876-46322898 GAAGCCAAAATTGAATTGTTAGG + Intronic
1149296175 17:55264548-55264570 GTAGCCAAGTTTGAGATGATTGG - Intergenic
1158513773 18:58114110-58114132 GAAACCACTTTTGAGTTTTTAGG + Intronic
927446598 2:23167684-23167706 CAAGCCAATTTTGATGAGATGGG + Intergenic
927911640 2:26904002-26904024 AATGCTAATTTTGAGTTGGTGGG - Intronic
932908557 2:75781240-75781262 GAAGCCAATTTGAATTAGATTGG + Intergenic
937199044 2:120185267-120185289 GCAGGCAGTTTTCAGTTGATGGG - Intergenic
939377428 2:141387372-141387394 GAAGCAAATTTTGATTTCATTGG - Intronic
941485983 2:166083231-166083253 TAAGCCAATTTTTAGTAGGTTGG + Intronic
941564921 2:167094854-167094876 GAAGCCAATTGTAGCTTGATGGG + Intronic
942902596 2:181140218-181140240 GAAGCCAGTTATGAGGTGGTTGG + Intergenic
943037387 2:182764203-182764225 GAAGCCACTTTTGAATGGCTAGG - Intronic
947944698 2:234091606-234091628 GATGCCAATTTTCTGTTGAATGG - Intergenic
1173351976 20:42253611-42253633 GATGCCAATTCTGATTTGCTTGG - Intronic
1173758096 20:45535754-45535776 GAAACCAATGTTGAGCAGATTGG - Intronic
1178226570 21:30726036-30726058 TTAGCCAACTTTGAGGTGATAGG + Intergenic
1180083635 21:45497798-45497820 GAAGCCCCTTCTGGGTTGATGGG + Intronic
1180474641 22:15690904-15690926 GAAGGAAATTATGATTTGATTGG - Intronic
1181788159 22:25242589-25242611 GAAGGCAACATTGAGTGGATTGG + Intergenic
1181819902 22:25467602-25467624 GAAGGCAACTTTGAGTGGATTGG + Intergenic
1184761125 22:46545103-46545125 GAAGCCAGTTATCAGTTGCTGGG - Intergenic
952074268 3:29676319-29676341 GATGTAAATTATGAGTTGATGGG + Intronic
952493660 3:33896871-33896893 GAAGCCTATTTGGACTTCATGGG - Intergenic
952728501 3:36614990-36615012 GAAGCCAATTTTGAGAGAAATGG - Intergenic
955819027 3:62875900-62875922 GAATCAAATTTTGAATGGATTGG + Intergenic
957275260 3:78082941-78082963 GGAGCCAATTTTGATTAGTTGGG - Intergenic
959979670 3:112502007-112502029 GAAACCAATTATGAGTTGGCAGG + Intergenic
960796915 3:121497304-121497326 GCATCCAATTTTGATTTGAAAGG + Intronic
962459933 3:135601496-135601518 GAAGCCAAAATTCAGTTGAATGG + Intergenic
964596645 3:158439708-158439730 GATGTAAATGTTGAGTTGATGGG + Intronic
965921711 3:173924966-173924988 AAAACCAATTTTGAGTTTTTTGG + Intronic
966572637 3:181463049-181463071 GAAGGCAGTTTTGATTTCATAGG - Intergenic
967165188 3:186773777-186773799 GATGCCAACTCTGAGATGATAGG - Intergenic
970040205 4:11787863-11787885 GAAACATATTTTGAGTTGATTGG - Intergenic
972411375 4:38798739-38798761 AAAGTGAATTTTTAGTTGATAGG - Exonic
972952911 4:44350942-44350964 GTAGCCAATATTGAGTTAATTGG - Intronic
974422814 4:61699554-61699576 AAAGCCAATTTTGAGTTTAAAGG + Intronic
975366098 4:73529770-73529792 GAAGCCAATTCTGAATTTCTAGG + Intergenic
976118046 4:81749516-81749538 GATGCTAATTTTAAGATGATGGG + Intronic
976231968 4:82853399-82853421 GAAGCAAAGTTTGAGATGATAGG - Intronic
976267530 4:83198193-83198215 GCAGCCAATTTTGATATGCTTGG + Intergenic
976589925 4:86838974-86838996 GAAGCAAATATTTAGCTGATTGG + Intronic
977490958 4:97710732-97710754 GAAGTTACTTTTAAGTTGATGGG - Intronic
977989319 4:103421568-103421590 GATGCCAATTTTTAGTTACTTGG - Intergenic
980874727 4:138649588-138649610 TAAGCCATTTTTGTGTTCATAGG - Intergenic
984179256 4:176462078-176462100 GTATCCAATTCAGAGTTGATGGG - Intergenic
985210130 4:187584054-187584076 GAAGCCAGTTCTAAGGTGATTGG - Intergenic
986416088 5:7529668-7529690 GAAGCCAATGTTTACTTGAGGGG - Intronic
986840113 5:11687123-11687145 GAAGCCAGTTTGGAGGTTATTGG - Intronic
987320233 5:16761956-16761978 GAAGCCAATCATGAATTTATTGG - Intronic
988543139 5:32130439-32130461 GATACCAAATTAGAGTTGATAGG - Intronic
989176357 5:38530869-38530891 GAGGCCAATTTTCAAATGATGGG + Intronic
990763381 5:59155423-59155445 GAAGACAATTAGGAGTTCATTGG + Intronic
991583195 5:68177782-68177804 GAGGTAAATTTTGAGCTGATGGG + Intergenic
991694690 5:69259647-69259669 CAATCCAATTTTGCTTTGATGGG + Intronic
993315597 5:86402182-86402204 GAAGCCAATTTTCAGAATATGGG - Intergenic
993355241 5:86898106-86898128 GAAAAACATTTTGAGTTGATGGG + Intergenic
993695549 5:91057682-91057704 GAAGCCAATTTTTTTTGGATGGG + Intronic
994783771 5:104128640-104128662 GAAGCCAATTTCCAGTCTATAGG - Intergenic
994864210 5:105244637-105244659 AAATTCAATTTTGAGTTCATTGG - Intergenic
1001174487 5:169453835-169453857 GAATCAAATTTTGATTTCATTGG + Intergenic
1002096293 5:176833104-176833126 GAGGCCAAGTTGGAGTTGAGAGG + Intronic
1002309305 5:178305188-178305210 GAAGCCTGTTTTGAGTTCAATGG - Intronic
1003454497 6:6269206-6269228 GAAGCAAAGTTTTAGTTGACAGG - Intronic
1004073954 6:12328347-12328369 GAAAGCAATCTTAAGTTGATAGG + Intergenic
1005532095 6:26718420-26718442 GAAGCTAGTTTCTAGTTGATAGG + Intergenic
1005538700 6:26783245-26783267 GAAGCTAGTTTCTAGTTGATAGG - Intergenic
1006994841 6:38249579-38249601 GAAGCCAATTATGGCTTGTTTGG - Intronic
1009009553 6:57825480-57825502 GAAGCTACTTTCTAGTTGATAGG - Intergenic
1011969384 6:93203289-93203311 GAAGCTAATTTTATGTTAATTGG + Intergenic
1016684878 6:146869848-146869870 GAAGCCCACTTTGGGCTGATCGG - Intergenic
1018019524 6:159746746-159746768 TAAATCTATTTTGAGTTGATTGG - Intronic
1025872457 7:65447708-65447730 GAAGCCATTTTTGAATTCAGAGG + Intergenic
1027877108 7:83784817-83784839 GAAGCCAATGTTAAGTTCATTGG - Intergenic
1031266105 7:119583325-119583347 GATGCCAATTTTGAGGTAAAGGG - Intergenic
1034089384 7:148349966-148349988 GAAGTTTATTATGAGTTGATGGG + Intronic
1034195295 7:149241715-149241737 GAAGCCAACTTTGAGGGCATTGG + Intronic
1036010842 8:4720975-4720997 GAAGACAATTTTTATTTGAATGG + Intronic
1037673556 8:21035795-21035817 AAAGCCACTTTTGATTTGAGAGG + Intergenic
1039014128 8:33127307-33127329 AATGCAAATTTTGACTTGATAGG - Intergenic
1039986069 8:42449047-42449069 GAAGCCAGTCTTGAGTTTTTAGG - Intronic
1045031427 8:98140165-98140187 GAAGCCATTTTCGAGTTGTTGGG + Exonic
1046151577 8:110233607-110233629 GAAACCAAATTTGACTTGATGGG - Intergenic
1046158914 8:110333134-110333156 GAAGCACATTTTGACGTGATAGG + Intergenic
1046734313 8:117760231-117760253 GAATTCCATTTTGAGTTGAAAGG + Intergenic
1050691162 9:8228017-8228039 GAAGTCAATTTTGACTCGTTAGG - Intergenic
1051404754 9:16724621-16724643 GAAGCCAATTTAGATTTAGTGGG - Intronic
1051550841 9:18327421-18327443 TAACCCAGTTTTGAGTTGAAAGG - Intergenic
1052238752 9:26247041-26247063 CAAGCCAGTTTTGAGATTATAGG + Intergenic
1055850952 9:80629357-80629379 GATGTCAATTTTGAGATGACTGG + Intergenic
1057893698 9:98889418-98889440 GCAGACATTTTTGAGTTGTTTGG + Intergenic
1060350584 9:122855279-122855301 GCACCCCATTTTGAGATGATGGG + Exonic
1186363493 X:8867752-8867774 GAAGCCTATTGGGAGTTGTTTGG - Intergenic
1186900137 X:14045700-14045722 GCACCCACTTTGGAGTTGATGGG + Intergenic
1186959940 X:14724955-14724977 GAAGCCATTTGGGATTTGATAGG + Intronic
1187119038 X:16385403-16385425 GAGGCCATTTTGGACTTGATTGG - Intergenic
1187947135 X:24437084-24437106 GAAGCCAATGTTTAGTTGTGTGG + Intergenic
1188505700 X:30881944-30881966 GAAATTAATTTTGAGTTGTTTGG - Intronic
1188905292 X:35784229-35784251 GAAGCCAATTTTGTGTAAGTTGG + Intergenic
1189534211 X:41920579-41920601 CAAGCTAATTTTGAGGTGATAGG - Intronic
1189955041 X:46269228-46269250 GAAACCAATTTAGCCTTGATGGG - Intergenic
1191799546 X:65062696-65062718 AAAGTCAATTGTGACTTGATGGG + Intergenic
1193202803 X:78712213-78712235 CAAGGCAATTTTGAGTTGAGTGG + Intergenic
1195952306 X:110287845-110287867 GAAGCCAAACTGCAGTTGATGGG + Intronic
1196641192 X:118063439-118063461 GAAGCCCACTTAGAGTTAATGGG - Intronic
1198741243 X:139845180-139845202 GAAGCCTGTTTTGAGCTGACTGG - Intronic
1200931944 Y:8704886-8704908 GAAGCCAAATGTGAGTGGAATGG - Intergenic
1201426808 Y:13860182-13860204 GAAGACAATTTTACCTTGATCGG + Intergenic