ID: 1115500175

View in Genome Browser
Species Human (GRCh38)
Location 14:34042653-34042675
Sequence AAGGGTAGGACTTTGCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115500166_1115500175 13 Left 1115500166 14:34042617-34042639 CCAGGGAGGGGGCTTCAGGGAAG 0: 1
1: 0
2: 7
3: 52
4: 451
Right 1115500175 14:34042653-34042675 AAGGGTAGGACTTTGCCAAGGGG 0: 1
1: 0
2: 4
3: 12
4: 160
1115500163_1115500175 20 Left 1115500163 14:34042610-34042632 CCTAGAACCAGGGAGGGGGCTTC 0: 1
1: 0
2: 2
3: 21
4: 196
Right 1115500175 14:34042653-34042675 AAGGGTAGGACTTTGCCAAGGGG 0: 1
1: 0
2: 4
3: 12
4: 160
1115500172_1115500175 -10 Left 1115500172 14:34042640-34042662 CCAGTGGCAAAGGAAGGGTAGGA 0: 1
1: 0
2: 3
3: 25
4: 218
Right 1115500175 14:34042653-34042675 AAGGGTAGGACTTTGCCAAGGGG 0: 1
1: 0
2: 4
3: 12
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115500175 Original CRISPR AAGGGTAGGACTTTGCCAAG GGG Intronic
900599049 1:3495347-3495369 AAGGGTGGGACCAGGCCAAGAGG + Intronic
901554167 1:10018509-10018531 AAAGGTAGGGGTTTGCAAAGGGG - Intergenic
905286363 1:36883106-36883128 AGGGGTAGGCCTGTGCCCAGTGG - Intronic
907391350 1:54160417-54160439 AGGGATGGGACTGTGCCAAGAGG + Intronic
908784606 1:67722591-67722613 AAGGGTAGGAACTTGACAGGTGG + Intronic
909073392 1:71024010-71024032 AAATGAAGGACTTTGCAAAGTGG - Intronic
911537848 1:99122049-99122071 AAGGTTAGGACTTTACAAAAAGG - Intergenic
911673201 1:100630467-100630489 AAAAGTAAGATTTTGCCAAGTGG + Intergenic
914753561 1:150550872-150550894 AAGGGTAGGAATGTGCCTGGGGG - Intronic
915297150 1:154929502-154929524 AAGGCTAAGCCTTTGCCCAGGGG - Intronic
915449684 1:155995967-155995989 AAGGGTAGATCTTTGAGAAGAGG - Intronic
916470017 1:165114296-165114318 AAGCGGAGGAGTTTGCAAAGAGG + Intergenic
919763235 1:201111363-201111385 AAGGGGAGGGCTGTGTCAAGTGG - Intronic
922027158 1:221760931-221760953 TAGGGAAAGACTTTGCCAACCGG + Intergenic
922297068 1:224260055-224260077 AAGGGCAGTACTGTGCCAAAGGG + Intronic
924104392 1:240635938-240635960 AAGGGTGGGGCTGTCCCAAGAGG + Intergenic
924907848 1:248475302-248475324 AAGGTCAGGGCTGTGCCAAGGGG - Intergenic
1064846865 10:19665433-19665455 AGGGGTAGGACCTTCCTAAGGGG + Intronic
1065383013 10:25108920-25108942 AAAGGTAGGACTTCTCAAAGTGG - Intergenic
1067691063 10:48502643-48502665 ATGAGTAGGAGTTTGCCAGGTGG - Intronic
1067908613 10:50320774-50320796 AGGAATAGGAGTTTGCCAAGTGG - Intronic
1070052845 10:72905769-72905791 ATGGGGAGAACTTTGCCCAGTGG - Intronic
1070336976 10:75464494-75464516 AAGGGAGGAACTTTGCCAAGAGG + Intronic
1072008881 10:91286383-91286405 AAGAGCAGGACTTTGTAAAGAGG - Intergenic
1072835452 10:98706650-98706672 AAGGGTAGGATTTTGCCAGGAGG + Intronic
1073885749 10:108037674-108037696 AAGAGTTTGACTTTGCCTAGAGG - Intergenic
1075712444 10:124537910-124537932 AAGGGAAGGACACGGCCAAGGGG + Intronic
1078026216 11:7698099-7698121 AGGAGTAGGATTTTGTCAAGTGG - Intronic
1079385236 11:19972905-19972927 ACATGTAGGACTTTGCCCAGAGG - Intronic
1080498796 11:32848676-32848698 AAGGGTAAGAATTTGGCCAGGGG + Intronic
1082895047 11:58181193-58181215 AATGGTATAACTTTGCTAAGTGG - Exonic
1083409830 11:62484494-62484516 AAGGGGAAGACTTTGTCAAGGGG + Intronic
1084168581 11:67389342-67389364 AGGGGTAAGACGATGCCAAGTGG + Intronic
1084394016 11:68897097-68897119 AAGGAGAGGACTTTGCAATGAGG + Intronic
1085538749 11:77245931-77245953 AAGGGTAGGATTTTAACAAGTGG - Intronic
1085710787 11:78827438-78827460 ATGGATAGGACTTGGACAAGCGG - Intronic
1089046611 11:115506141-115506163 ACGGGTAGGACTTTGCAGACTGG - Intergenic
1095624565 12:44299467-44299489 TAGGGTAGGTGCTTGCCAAGGGG + Intronic
1095687442 12:45051345-45051367 AAGGGTAGTGCTGTGGCAAGGGG + Intergenic
1097280082 12:57839780-57839802 GAGGGAAGGACTTTGCCCAAGGG - Intronic
1097353698 12:58577648-58577670 AAGGCTAGGACATGGCCAAAAGG + Intronic
1097942037 12:65320700-65320722 GAGGGTAGCACTTTGCTAAATGG + Intronic
1099468116 12:83011694-83011716 TTCGGTAGGACTTTGCTAAGTGG - Intronic
1100629610 12:96374586-96374608 AAGTATAAGAATTTGCCAAGAGG - Intronic
1101063000 12:100990791-100990813 AAGGATAAGACTTGCCCAAGTGG + Intronic
1102313729 12:111868400-111868422 AAGGGTAGGAATTTTCCAGATGG + Intronic
1102476606 12:113192698-113192720 ATGGCTAGGACTTTGCCAAGTGG + Intergenic
1103506351 12:121444165-121444187 AAGGGCAGGAACCTGCCAAGCGG - Exonic
1104370906 12:128223135-128223157 AAGGGGATGACTTTGTGAAGGGG + Intergenic
1105446937 13:20465692-20465714 AGGGCCAGGTCTTTGCCAAGAGG - Intronic
1105996411 13:25676625-25676647 AAAGGTTGAAGTTTGCCAAGTGG + Intronic
1110614144 13:77522295-77522317 ATGGTTAGGAATTTGCCCAGAGG + Intergenic
1114897408 14:27008913-27008935 AAGGGTAAGATTTGGCCATGTGG + Intergenic
1115133970 14:30086765-30086787 AAGGGAAGGACTTTGTCTTGTGG + Intronic
1115500175 14:34042653-34042675 AAGGGTAGGACTTTGCCAAGGGG + Intronic
1127403244 15:58613038-58613060 AATGGTGAGACTTAGCCAAGGGG - Intronic
1128054307 15:64688397-64688419 TAGGGGAGGACATTGCCTAGAGG - Exonic
1128602928 15:69012948-69012970 ATGAGTAGGAGTTTGCCAGGTGG - Intronic
1129602882 15:77010408-77010430 AAGGGCAGGACCTTCCCAGGAGG - Intronic
1131118738 15:89809957-89809979 ATGAGTAGGAGTTTGACAAGAGG - Intronic
1133920573 16:10149397-10149419 AAATCTAGGACTTTGCCCAGTGG + Intronic
1135173541 16:20208168-20208190 ATGTGTAGGAGTTTGTCAAGGGG - Intergenic
1137530576 16:49276427-49276449 CAGGATAGGATTTTGCAAAGCGG + Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139957363 16:70699528-70699550 AAGGATCGGACTTTGTGAAGAGG + Intronic
1140245717 16:73246115-73246137 AAGGGTGGCACTTTGGCCAGAGG + Intergenic
1140746996 16:77989294-77989316 AAGGGTGGGTCTTTCCCCAGAGG - Intergenic
1141978819 16:87536672-87536694 AAAGGTAGGGGTTTGCAAAGGGG + Intergenic
1147391361 17:40111448-40111470 TGGGGTGGGACTTGGCCAAGGGG - Intergenic
1147441635 17:40451077-40451099 AAGACGAGGACTGTGCCAAGGGG - Intronic
1148868846 17:50643703-50643725 TAGGTTAGGATTTTGACAAGTGG + Intronic
1148956121 17:51355070-51355092 AAGGGTGGGACTGAACCAAGTGG + Intergenic
1150302802 17:64060210-64060232 ATGGGTAGGATTTGGCCAGGTGG - Intronic
1155224097 18:23713335-23713357 ACGGATAGGACTTTGGTAAGTGG - Intronic
1157079112 18:44502557-44502579 AAGAATAGGAATTTGCTAAGAGG - Intergenic
1157627289 18:49061295-49061317 AAGGGTAGGATTTGGGCATGTGG + Intronic
1160302753 18:77700511-77700533 GAGGGTAGGACTTGGACTAGAGG + Intergenic
1161785450 19:6322468-6322490 ATGAATAGGAGTTTGCCAAGTGG - Intronic
1161786150 19:6326984-6327006 ATGAATAGGAGTTTGCCAAGTGG - Intronic
1162914258 19:13865677-13865699 GAGGGTCGGACTCTGCAAAGGGG + Intronic
1163785193 19:19271345-19271367 ATGAGTAGGAGTTTGCCAAGTGG - Intronic
1164778042 19:30869618-30869640 AAGGGCAGGACTTTGCCCAGAGG - Intergenic
1165645479 19:37431967-37431989 GTGGGAAGGACTTTGCCATGTGG + Intronic
1168549905 19:57284130-57284152 AAGGTTAGGACAATCCCAAGTGG - Intronic
925157771 2:1660611-1660633 CAGGGTAAGACATTGCCCAGTGG + Intronic
928256845 2:29730113-29730135 AATGGCAGGTCCTTGCCAAGGGG - Intronic
928460247 2:31465760-31465782 AGGGGTAGAGGTTTGCCAAGGGG + Intergenic
930055301 2:47247391-47247413 AAGGGCAGGACTTGGACAGGTGG + Intergenic
931613440 2:64129098-64129120 AAGGGTGGCACTTTGGCAAATGG - Intronic
932691949 2:73921004-73921026 AAGGCTGGGACTTTGCTAGGTGG - Intergenic
933781457 2:85804715-85804737 AAGGGTAGGAAGGTGGCAAGAGG + Intergenic
935130078 2:100255114-100255136 AAGGGTAGGAGCTTGCCAGCAGG - Intergenic
935839885 2:107097820-107097842 AAGGGGAGGACATTGCAAAAAGG + Intergenic
936286057 2:111182274-111182296 AGGGTTGGGACTTTGCCAAGGGG - Intergenic
936531441 2:113279029-113279051 AAGGGGAGGATTTTGCAAGGGGG + Intergenic
936628719 2:114176967-114176989 CAGGGTAGGAAAATGCCAAGAGG - Intergenic
939727981 2:145747086-145747108 AATTTTAGGACTTTGCCAGGTGG + Intergenic
941742283 2:169047482-169047504 AAGGGAAGGACTTTGTCTTGTGG + Intergenic
944642461 2:201742322-201742344 AAGGGTTGGGCTTTTCAAAGAGG - Intronic
946048104 2:216837875-216837897 AAGGGCAGGATTTAGACAAGGGG - Intergenic
946429812 2:219619406-219619428 AAGGGTCTGTCTTTGCCACGTGG + Intergenic
1170359518 20:15529510-15529532 AAGGGTAGGAAATAACCAAGTGG + Intronic
1173875304 20:46366673-46366695 GAGGGCAGGACTTGGCCAGGAGG + Exonic
1176175450 20:63721096-63721118 AATGCTAGGACTTTGGGAAGTGG + Intronic
1176199111 20:63852288-63852310 ATGGGTAGGGCTTTGCAAACTGG - Intergenic
1176300611 21:5097270-5097292 AAGGGCAGGACTGTGACAGGAGG - Intergenic
1178713643 21:34943439-34943461 ATGTGAAGTACTTTGCCAAGAGG - Intronic
1178803374 21:35817788-35817810 AAGGGTGGTAGTTTGCAAAGTGG + Intronic
1179856432 21:44164711-44164733 AAGGGCAGGACTGTGACAGGAGG + Intergenic
1182774320 22:32819627-32819649 AAGGGCAGATCTATGCCAAGAGG - Intronic
1184041340 22:41945983-41946005 AAGGGAGGGACTTTGCCAAGTGG + Exonic
949934734 3:9107940-9107962 ATGGGTAGGAGTTTTCCAAATGG + Intronic
950096867 3:10335697-10335719 AAGGGTTGGAGTTGGACAAGAGG - Intronic
951063761 3:18240244-18240266 AAGGGAAGGATTTGGCCAAAAGG - Intronic
961254827 3:125540540-125540562 AAGGGAAGGATGTTGGCAAGTGG - Intronic
963265604 3:143237391-143237413 CAGGGTGGAACTTTGCCAAAAGG - Intergenic
966861257 3:184231951-184231973 AAGGGTAGGACTCAGTTAAGTGG + Intronic
972369616 4:38410435-38410457 AAGAGGAGGATTTAGCCAAGGGG + Intergenic
977090049 4:92661022-92661044 TATTGTAGGACTTTGTCAAGTGG + Intronic
977298463 4:95238286-95238308 AAGGGTAGGAAATTGGCAAAAGG - Intronic
977532466 4:98216448-98216470 AAGGATAAGACTTCGCCAAGAGG + Intergenic
978417260 4:108489569-108489591 AAGGGCTGGGCTTTGCGAAGGGG - Intergenic
978487802 4:109275948-109275970 ATGGGTAGGTGTTTGCCCAGTGG - Intronic
978534941 4:109750946-109750968 ATGGGTAGGAATTTGCCATAAGG - Intronic
981225876 4:142293790-142293812 AAGGGTAATACATTGCCAAGAGG + Intronic
986145844 5:5076886-5076908 AAGAGTAGTACTTATCCAAGGGG + Intergenic
986501096 5:8400907-8400929 AAGGGGAGGACTTGGCTGAGGGG - Intergenic
987149108 5:15020940-15020962 AAGGATAGGAATTTGCCTTGTGG - Intergenic
988140193 5:27228373-27228395 AAGGGTAGAACTTTATCAACAGG + Intergenic
988932209 5:36047714-36047736 AAGGGGAGGACATTGTTAAGAGG - Intronic
992352703 5:75947417-75947439 AAGGGATGGAATTTTCCAAGGGG - Intergenic
992500751 5:77340560-77340582 AAGGGTAGGACTGGGCAAGGCGG - Intronic
996094282 5:119381699-119381721 AAGGGTGGCACTTTGGCCAGAGG + Intronic
996337632 5:122402101-122402123 AAGAGTGAGACTTTGCCAAAGGG + Intronic
996603982 5:125298890-125298912 AAGAGTAGGAATGTGCCAGGCGG + Intergenic
997125872 5:131226365-131226387 AAGTGTAGGAATTTGTTAAGGGG - Intergenic
997411170 5:133692143-133692165 AAGGGTAGGAGTCTGCCAGATGG + Intergenic
997786629 5:136719476-136719498 AAGAGTAGAACTTGCCCAAGTGG + Intergenic
998622147 5:143806696-143806718 AACAGAAGGACTTTCCCAAGTGG - Intergenic
1000535418 5:162472324-162472346 AATGGAAGAACTTTGCTAAGGGG + Intergenic
1001796691 5:174508176-174508198 AGGGGTAGGAGTTGGCCAGGTGG + Intergenic
1002506017 5:179679581-179679603 AGGAGTAGGACTTTGCCAGGTGG + Intronic
1003261976 6:4525704-4525726 AAGAGCAGGCCTTTGGCAAGTGG + Intergenic
1006022704 6:31126729-31126751 AAGAGGAGGAATTTGGCAAGTGG + Intronic
1006678049 6:35777699-35777721 ATGAGTAGGAGTTTGCCAAGTGG - Intronic
1006770518 6:36548744-36548766 ATGGGTAGGACTTTGACAACAGG - Intergenic
1006956554 6:37878525-37878547 AGGGGCAGGGCTATGCCAAGCGG - Intronic
1009591049 6:65671745-65671767 AAGGGCAGGGCTTTGGCAAGTGG - Intronic
1010205998 6:73323026-73323048 ATGGGCATGACTGTGCCAAGTGG + Intergenic
1016893590 6:149031893-149031915 GTGCGTAGGAGTTTGCCAAGTGG + Intronic
1017740667 6:157403938-157403960 AACGGGAGGACTTTTCCCAGTGG + Intronic
1022547608 7:31203352-31203374 ATGGGGAGGACTTTCCTAAGGGG + Intergenic
1023307183 7:38842718-38842740 AAGAGCTGGAATTTGCCAAGTGG - Intronic
1023570052 7:41562510-41562532 GAGGGCAGGGCTTTGCCAACTGG + Intergenic
1028244123 7:88455321-88455343 AAGGTTAGGAATTAGCCAAATGG + Intergenic
1035110255 7:156475842-156475864 ATGAGTAGGAGTCTGCCAAGTGG - Intergenic
1037718392 8:21419351-21419373 AAGGGGAGGACTAGGCAAAGGGG - Intergenic
1038022317 8:23560934-23560956 AAGGGTAGGCATTAGGCAAGTGG + Intronic
1040870138 8:52092181-52092203 AAGGGGAGGATTTGGACAAGAGG - Intergenic
1042221490 8:66478683-66478705 ATGGGCAGGAGTTTGCCATGAGG - Intronic
1047409672 8:124614183-124614205 AAGGGTAGGAATATAGCAAGAGG + Intronic
1048250579 8:132863642-132863664 AAGATTAGGACATTGCCATGTGG + Intergenic
1050787495 9:9424006-9424028 TAGAGTAGGATTTGGCCAAGGGG - Intronic
1051659724 9:19414610-19414632 CAGGGTAGGGTTTTGCCATGTGG - Intronic
1056219530 9:84437597-84437619 AAGGATAGGAGGTAGCCAAGAGG - Intergenic
1056596837 9:88014721-88014743 TAGGGTAGGACTTGGCCTAAAGG + Intergenic
1057410693 9:94814437-94814459 GAGGTTAGGACTTTCCCAGGAGG + Intronic
1057517831 9:95736980-95737002 AAGGTTAGAAGTTTGCCCAGAGG + Intergenic
1059657494 9:116369641-116369663 AAGGGTGGGAATTTGCCCAGGGG - Intronic
1059992087 9:119875069-119875091 TTGAGTAGGACCTTGCCAAGTGG + Intergenic
1186873935 X:13798745-13798767 AAGCGTAGGACCTAGCCCAGGGG + Intronic
1187082730 X:16008022-16008044 AAGGGTAGGCATTTTCCCAGGGG + Intergenic
1194578287 X:95640459-95640481 GTGGGTAGGCCTTTGCCAATGGG + Intergenic
1196538229 X:116873070-116873092 AAGGCTATGACTTGGCCCAGTGG - Intergenic
1197103306 X:122682231-122682253 AAAGGGAGGACTTGGCGAAGAGG + Intergenic
1199608547 X:149595098-149595120 AAGGGTAGGACGGTGCCCATGGG + Intergenic
1199630575 X:149774262-149774284 AAGGGTAGGACGGTGCCCATGGG - Exonic