ID: 1115501473

View in Genome Browser
Species Human (GRCh38)
Location 14:34053725-34053747
Sequence TGGGATTCCCAGTCAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115501466_1115501473 11 Left 1115501466 14:34053691-34053713 CCACACCCACTAACTTTAGGAGC 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1115501473 14:34053725-34053747 TGGGATTCCCAGTCAAAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 114
1115501468_1115501473 5 Left 1115501468 14:34053697-34053719 CCACTAACTTTAGGAGCAGTCCT 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1115501473 14:34053725-34053747 TGGGATTCCCAGTCAAAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 114
1115501464_1115501473 19 Left 1115501464 14:34053683-34053705 CCAGGAATCCACACCCACTAACT 0: 1
1: 0
2: 2
3: 3
4: 132
Right 1115501473 14:34053725-34053747 TGGGATTCCCAGTCAAAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 114
1115501463_1115501473 20 Left 1115501463 14:34053682-34053704 CCCAGGAATCCACACCCACTAAC 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1115501473 14:34053725-34053747 TGGGATTCCCAGTCAAAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 114
1115501467_1115501473 6 Left 1115501467 14:34053696-34053718 CCCACTAACTTTAGGAGCAGTCC 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1115501473 14:34053725-34053747 TGGGATTCCCAGTCAAAACCAGG 0: 1
1: 0
2: 0
3: 13
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115501473 Original CRISPR TGGGATTCCCAGTCAAAACC AGG Intronic
900213094 1:1467115-1467137 TGGGATTCTGGGGCAAAACCTGG - Intronic
900218307 1:1494171-1494193 TGGGATTCTGGGGCAAAACCTGG - Intronic
902519950 1:17010645-17010667 TAGGATTCCCATTTAAAACGAGG + Intronic
902680835 1:18042698-18042720 AGGGATTCCCTCTCAAAACAGGG + Intergenic
902914365 1:19627611-19627633 TGGGATTCCCAGTCAACTTCGGG - Exonic
904706147 1:32392455-32392477 TGGAATTCCCAGTTAAAAGCTGG - Intronic
905767443 1:40612920-40612942 TGGGTTTCCCAGCCCAAACCTGG - Intergenic
907944630 1:59124081-59124103 TAGCTTTCCAAGTCAAAACCTGG - Intergenic
914838049 1:151224655-151224677 TGGGATTCAAATTCAAACCCAGG + Intronic
915822694 1:159042247-159042269 TTGGGTTTCCAATCAAAACCAGG - Intronic
917370084 1:174283442-174283464 AGGCATTCTCAGTCAAAATCTGG - Intronic
918187716 1:182142782-182142804 TGGGCATCCTGGTCAAAACCAGG + Intergenic
920873929 1:209817011-209817033 TGGGATTGCCAGTAAAATCAAGG - Intergenic
923211631 1:231808800-231808822 TGGGCATCCCAGGTAAAACCTGG + Intronic
923730662 1:236546834-236546856 TGGGAATCCCAGTTCCAACCAGG - Intronic
1063543079 10:6954298-6954320 TGGAATTTCCAGTAAAAACCTGG + Intergenic
1068029989 10:51694441-51694463 TGTGAATCCCAGTCAAAAGTAGG - Intronic
1069764223 10:70841135-70841157 TGGCAATACCAGCCAAAACCTGG - Intronic
1070337605 10:75469111-75469133 TGGGTTTCCCTGCCAAAACTGGG + Intronic
1071164362 10:82787267-82787289 TGGGATACACAGCTAAAACCAGG - Intronic
1071262101 10:83929645-83929667 TTGGATTCCCAGTCTGACCCAGG + Intergenic
1071265260 10:83958807-83958829 TGGCACTGCCAGTCAAAACAGGG + Intergenic
1073320536 10:102613676-102613698 TGAGATTCACAGCCCAAACCAGG + Intronic
1076603304 10:131673429-131673451 TGGGATGCCCAGTCAACAGGCGG - Intergenic
1078473984 11:11614654-11614676 TGGGATTCAGAGTCACAAACAGG - Intronic
1078484134 11:11706123-11706145 TCACATTCCCAGTAAAAACCTGG - Intergenic
1086267765 11:85021584-85021606 TGAGATTCCCAGTGAACACACGG + Intronic
1087728969 11:101757328-101757350 TTGCATTCCAAGTCAAAACGTGG - Intronic
1093143825 12:15540895-15540917 TTGGATTCTCAGTCCAAACCCGG + Intronic
1093385704 12:18550792-18550814 TGGGATCCCGAGCCAAGACCAGG + Intronic
1102035886 12:109770187-109770209 TGGGCCTCCCAGTTAAAACCAGG - Exonic
1104361970 12:128141825-128141847 TGAGATTCCCAGGCAAACCCAGG - Intergenic
1112147926 13:96722301-96722323 TGGCTTTGCCAGTGAAAACCTGG - Intronic
1113230922 13:108214519-108214541 ACGGATTCCCAGTGAATACCTGG + Exonic
1115501473 14:34053725-34053747 TGGGATTCCCAGTCAAAACCAGG + Intronic
1129282582 15:74497547-74497569 TGGGATTCCAAGTCTCAAGCTGG + Intergenic
1131114527 15:89785692-89785714 TGACAATCCCAGGCAAAACCTGG + Intronic
1133523894 16:6585009-6585031 GCGGATTCCCAGGCAGAACCTGG + Intronic
1133653440 16:7835225-7835247 AGGGATTTCCAGCCAAAAGCTGG - Intergenic
1137762722 16:50953581-50953603 TGGGATTCACAGTCACCACCAGG + Intergenic
1140530411 16:75660910-75660932 AGGGATTCCCAGTCAACAGGTGG - Intronic
1140536523 16:75714832-75714854 AGGGATTCCCAGTCAACAGGTGG - Intronic
1140536534 16:75714883-75714905 AGGGATTCCCAGTCAACAGGTGG - Intronic
1143017104 17:3896701-3896723 TGGGAGCCCCAGCCAAATCCTGG - Exonic
1144673732 17:17147549-17147571 TGGGTTTCCCAGTCCCGACCTGG + Intronic
1146127332 17:30239431-30239453 TGGGGGTCCCAGGAAAAACCAGG - Intergenic
1149524182 17:57341127-57341149 GGGGCTCCCCAGTCAGAACCAGG + Intronic
1150658635 17:67056832-67056854 TCGGATTCCCAGTCACATCAGGG + Intergenic
1154975361 18:21452195-21452217 TATGATTCCCACACAAAACCTGG + Exonic
1155232958 18:23792652-23792674 TGGGTTTCCAAGCCAAAATCTGG - Intronic
1156538057 18:37882912-37882934 AAGGATTCCCAGGCAAACCCAGG - Intergenic
1159009141 18:63041685-63041707 TGGGATACCCAGTTGAAAGCAGG + Intergenic
1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG + Intergenic
1164384579 19:27761989-27762011 AGGGACTCCCAGCCAAATCCAGG - Intergenic
1166902593 19:46077268-46077290 TGAGATTCCAAGTCACACCCAGG - Intergenic
1167783096 19:51613291-51613313 TGGGGTTCCCATTCAAGGCCGGG + Intronic
1167906479 19:52664858-52664880 TGGGTTTCGCCTTCAAAACCTGG - Intronic
1168232847 19:55044399-55044421 TGGGAGTCCCAGGCAATCCCAGG + Exonic
1168469335 19:56627996-56628018 TAGGAATCCCAGTCAGTACCCGG + Intergenic
926249155 2:11143778-11143800 GGGGATCCCAAGTCCAAACCAGG + Intronic
928309928 2:30201080-30201102 TTGTATTCCCAGCAAAAACCTGG + Intergenic
929773484 2:44912914-44912936 TGGGACTCCCAGTCTCAATCTGG + Intergenic
932375972 2:71236061-71236083 TGGGCTACCAAGCCAAAACCTGG + Intergenic
935791032 2:106590411-106590433 TGTGATGTCCAGTCAAAAACTGG + Intergenic
938570547 2:132558355-132558377 TGGGATTCCTTGTCCAAATCAGG - Intronic
940576864 2:155519244-155519266 AGGCATTCCCTGTCAAAAACGGG - Intergenic
944198436 2:197080299-197080321 AGGCATTCCCAGTGAAAACACGG - Intronic
944993128 2:205260898-205260920 TGGGAGTCAAAGTCAAAAGCAGG - Intronic
946230900 2:218290781-218290803 TGGGATTCTAGGCCAAAACCTGG - Intronic
1169075819 20:2759309-2759331 TGGGATTCACAGCCACACCCCGG + Exonic
1169279578 20:4255609-4255631 TGAAATTCCCACTCAGAACCTGG + Intergenic
1172008605 20:31833678-31833700 AGGGAGTCCCAGTCAACACCAGG - Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1174260333 20:49290068-49290090 GGGGATTCTGAGTCAATACCAGG - Intergenic
1179035783 21:37757836-37757858 TTGGATTTCAAGTCAGAACCTGG - Intronic
1179943543 21:44654994-44655016 TGAGCTTCTCAGTCAAAACGGGG - Intronic
1179947113 21:44686044-44686066 TGAGCTTCTCAGTCAAAACGGGG + Intronic
1183311849 22:37114198-37114220 TGGGACTCACAGTCAAAAGGGGG - Intergenic
1184982040 22:48101812-48101834 TGGGATGCCCAGACAAAGGCCGG + Intergenic
954084098 3:48230462-48230484 AGGGGTTCCCAGACAATACCTGG - Intergenic
956077251 3:65518560-65518582 TGGGATTCCAAGTCACATCAAGG - Intronic
956105332 3:65811450-65811472 TTGGATTCCCAGTCCAAATATGG - Intronic
956791700 3:72685038-72685060 TGGAGTTCACAGTCAAAACAGGG + Intergenic
959081749 3:101809246-101809268 TGGTTTTCCTATTCAAAACCAGG - Intronic
960708193 3:120501936-120501958 TGGAATTCCATGTCAGAACCAGG + Intergenic
961339738 3:126209959-126209981 TGGGATACACAGCCAAACCCGGG - Intergenic
962705010 3:138034610-138034632 TGGGTCCCCCAGTCAAAACATGG + Intergenic
962748136 3:138412813-138412835 TGGGCTTCCAAGTCAGAACTGGG - Intergenic
962895316 3:139708689-139708711 TGGGATACCCAGCCACAGCCTGG - Intergenic
966112827 3:176424321-176424343 TGATATTCCCAGTCAAAAGCTGG + Intergenic
970345152 4:15146044-15146066 TTGGATTCCCAGCCATCACCAGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975233910 4:71968933-71968955 TGGGATTCCTAGTCACACCAGGG + Intergenic
976090906 4:81456600-81456622 TGGAATTCCCAGGCAGAGCCTGG - Intronic
981685052 4:147445001-147445023 TGGGTTGCCCAGTCAAATGCAGG + Intergenic
986041639 5:3999649-3999671 TGGGTTTCCAAGACAACACCTGG - Intergenic
987321947 5:16778503-16778525 TGGGATGCCCAGACAAGCCCTGG - Intronic
988514435 5:31892454-31892476 TGGGATAACCAGTTTAAACCAGG + Intronic
997233637 5:132260165-132260187 TGGGAGTCCAAGTCAGAACCAGG - Intronic
997569967 5:134919391-134919413 TGATATTCACAGTCTAAACCTGG - Intronic
999208301 5:149866100-149866122 TGGGATTTCCAGACAACAGCAGG - Intronic
1000805039 5:165779763-165779785 TGTCACTCCCTGTCAAAACCTGG - Intergenic
1003256213 6:4477204-4477226 GTGGATGCCCAGTCAGAACCTGG - Intergenic
1006603721 6:35242317-35242339 TGGGGTCCCCAGTCCAAACCTGG - Exonic
1009411325 6:63368437-63368459 TGGGATTCCCAGAGAATGCCAGG + Intergenic
1012970648 6:105726730-105726752 TGGGCTTCACAGTCAAATCCAGG + Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1015575204 6:134663997-134664019 TGGGAGTCCCAGTGAGAACTAGG + Intergenic
1019548112 7:1588158-1588180 TGGCCCTCCCAGTCAAAGCCGGG + Intergenic
1021185412 7:17558684-17558706 GGGTATTCTCAGTAAAAACCAGG + Intergenic
1022322997 7:29304574-29304596 TTGGGTACCCAGGCAAAACCTGG - Intronic
1029028656 7:97445474-97445496 CTGGATTCAGAGTCAAAACCAGG - Intergenic
1029809764 7:103035309-103035331 TGGGATTCCCAGACACAAATGGG + Intronic
1029934020 7:104403670-104403692 TGAGATTCCCAGCCAGATCCTGG - Intronic
1033176273 7:139126743-139126765 TGTGAATCTCAGTCAAAGCCAGG - Intergenic
1033930482 7:146514051-146514073 AGTGATTCTCAGTGAAAACCAGG - Intronic
1039915667 8:41858669-41858691 TGGGATCCCCTGTAAAATCCAGG + Intronic
1042715752 8:71770536-71770558 TGGAATTCCAATTCTAAACCTGG - Intergenic
1044226973 8:89730286-89730308 TGGAATTCCCTATCAGAACCTGG + Intergenic
1051590186 9:18769820-18769842 TGGTATGCCCAGTGAAAAGCTGG + Intronic
1057859878 9:98632584-98632606 TGGGATTCTGTCTCAAAACCCGG + Intronic
1059973274 9:119689595-119689617 TGGGATTCCCTTTCATGACCAGG + Intergenic
1060404069 9:123364509-123364531 TGGGATTTCCAGACAAGGCCTGG + Intronic
1188703828 X:33301195-33301217 TGGTATTACCTGTAAAAACCAGG + Intronic
1191952516 X:66608233-66608255 TGGGATTCACAGAAAAAACAGGG + Intronic
1193826543 X:86233505-86233527 TGGGATTTCAAGTCCCAACCTGG - Intronic
1195589458 X:106607613-106607635 TGGGATTGCCAGTAAACTCCTGG - Intergenic
1197208719 X:123812046-123812068 GGGGACTCCCAGGCATAACCTGG - Intergenic