ID: 1115502223

View in Genome Browser
Species Human (GRCh38)
Location 14:34060158-34060180
Sequence GTGTCCGCCGCGGCGCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115502223_1115502229 20 Left 1115502223 14:34060158-34060180 CCAGGGCGCGCCGCGGCGGACAC 0: 1
1: 0
2: 1
3: 3
4: 102
Right 1115502229 14:34060201-34060223 TGCGCCCGCGGCCGCCCCGAAGG 0: 1
1: 0
2: 1
3: 13
4: 129
1115502223_1115502227 8 Left 1115502223 14:34060158-34060180 CCAGGGCGCGCCGCGGCGGACAC 0: 1
1: 0
2: 1
3: 3
4: 102
Right 1115502227 14:34060189-34060211 ACGCACTGTGCCTGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1115502223_1115502232 27 Left 1115502223 14:34060158-34060180 CCAGGGCGCGCCGCGGCGGACAC 0: 1
1: 0
2: 1
3: 3
4: 102
Right 1115502232 14:34060208-34060230 GCGGCCGCCCCGAAGGTAGTCGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115502223 Original CRISPR GTGTCCGCCGCGGCGCGCCC TGG (reversed) Intronic