ID: 1115502224

View in Genome Browser
Species Human (GRCh38)
Location 14:34060168-34060190
Sequence GTGTGGCTCGGTGTCCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115502224_1115502237 26 Left 1115502224 14:34060168-34060190 CCGCGGCGGACACCGAGCCACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1115502237 14:34060217-34060239 CCGAAGGTAGTCGGTAACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1115502224_1115502238 29 Left 1115502224 14:34060168-34060190 CCGCGGCGGACACCGAGCCACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1115502238 14:34060220-34060242 AAGGTAGTCGGTAACTGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 30
1115502224_1115502229 10 Left 1115502224 14:34060168-34060190 CCGCGGCGGACACCGAGCCACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1115502229 14:34060201-34060223 TGCGCCCGCGGCCGCCCCGAAGG 0: 1
1: 0
2: 1
3: 13
4: 129
1115502224_1115502232 17 Left 1115502224 14:34060168-34060190 CCGCGGCGGACACCGAGCCACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1115502232 14:34060208-34060230 GCGGCCGCCCCGAAGGTAGTCGG 0: 1
1: 0
2: 0
3: 1
4: 32
1115502224_1115502239 30 Left 1115502224 14:34060168-34060190 CCGCGGCGGACACCGAGCCACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1115502239 14:34060221-34060243 AGGTAGTCGGTAACTGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1115502224_1115502227 -2 Left 1115502224 14:34060168-34060190 CCGCGGCGGACACCGAGCCACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1115502227 14:34060189-34060211 ACGCACTGTGCCTGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115502224 Original CRISPR GTGTGGCTCGGTGTCCGCCG CGG (reversed) Intronic