ID: 1115502225

View in Genome Browser
Species Human (GRCh38)
Location 14:34060180-34060202
Sequence CAGGCACAGTGCGTGTGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 289}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115502225_1115502243 29 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502243 14:34060232-34060254 AACTGCGGCGGGCGGCGGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 170
1115502225_1115502240 21 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502240 14:34060224-34060246 TAGTCGGTAACTGCGGCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 26
1115502225_1115502237 14 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502237 14:34060217-34060239 CCGAAGGTAGTCGGTAACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1115502225_1115502244 30 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502225_1115502239 18 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502239 14:34060221-34060243 AGGTAGTCGGTAACTGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1115502225_1115502241 24 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502241 14:34060227-34060249 TCGGTAACTGCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 48
1115502225_1115502242 28 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502242 14:34060231-34060253 TAACTGCGGCGGGCGGCGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 110
1115502225_1115502229 -2 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502229 14:34060201-34060223 TGCGCCCGCGGCCGCCCCGAAGG 0: 1
1: 0
2: 1
3: 13
4: 129
1115502225_1115502238 17 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502238 14:34060220-34060242 AAGGTAGTCGGTAACTGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 30
1115502225_1115502232 5 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502232 14:34060208-34060230 GCGGCCGCCCCGAAGGTAGTCGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115502225 Original CRISPR CAGGCACAGTGCGTGTGGCT CGG (reversed) Intronic