ID: 1115502227

View in Genome Browser
Species Human (GRCh38)
Location 14:34060189-34060211
Sequence ACGCACTGTGCCTGCGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115502224_1115502227 -2 Left 1115502224 14:34060168-34060190 CCGCGGCGGACACCGAGCCACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1115502227 14:34060189-34060211 ACGCACTGTGCCTGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 70
1115502223_1115502227 8 Left 1115502223 14:34060158-34060180 CCAGGGCGCGCCGCGGCGGACAC 0: 1
1: 0
2: 1
3: 3
4: 102
Right 1115502227 14:34060189-34060211 ACGCACTGTGCCTGCGCCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115502227 Original CRISPR ACGCACTGTGCCTGCGCCCG CGG Intronic