ID: 1115502230

View in Genome Browser
Species Human (GRCh38)
Location 14:34060205-34060227
Sequence ACTACCTTCGGGGCGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115502230_1115502238 -8 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502238 14:34060220-34060242 AAGGTAGTCGGTAACTGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 30
1115502230_1115502240 -4 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502240 14:34060224-34060246 TAGTCGGTAACTGCGGCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 26
1115502230_1115502239 -7 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502239 14:34060221-34060243 AGGTAGTCGGTAACTGCGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 38
1115502230_1115502247 27 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502247 14:34060255-34060277 GCTGGACAGCCAGCCCCGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 257
1115502230_1115502245 9 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502245 14:34060237-34060259 CGGCGGGCGGCGGCCGGGGCTGG 0: 1
1: 4
2: 49
3: 265
4: 1565
1115502230_1115502241 -1 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502241 14:34060227-34060249 TCGGTAACTGCGGCGGGCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 48
1115502230_1115502244 5 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502230_1115502242 3 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502242 14:34060231-34060253 TAACTGCGGCGGGCGGCGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 110
1115502230_1115502243 4 Left 1115502230 14:34060205-34060227 CCCGCGGCCGCCCCGAAGGTAGT 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1115502243 14:34060232-34060254 AACTGCGGCGGGCGGCGGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115502230 Original CRISPR ACTACCTTCGGGGCGGCCGC GGG (reversed) Intronic