ID: 1115502235

View in Genome Browser
Species Human (GRCh38)
Location 14:34060216-34060238
Sequence CGCAGTTACCGACTACCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 14}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115502235_1115502245 -2 Left 1115502235 14:34060216-34060238 CCCGAAGGTAGTCGGTAACTGCG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1115502245 14:34060237-34060259 CGGCGGGCGGCGGCCGGGGCTGG 0: 1
1: 4
2: 49
3: 265
4: 1565
1115502235_1115502242 -8 Left 1115502235 14:34060216-34060238 CCCGAAGGTAGTCGGTAACTGCG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1115502242 14:34060231-34060253 TAACTGCGGCGGGCGGCGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 110
1115502235_1115502247 16 Left 1115502235 14:34060216-34060238 CCCGAAGGTAGTCGGTAACTGCG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1115502247 14:34060255-34060277 GCTGGACAGCCAGCCCCGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 257
1115502235_1115502248 20 Left 1115502235 14:34060216-34060238 CCCGAAGGTAGTCGGTAACTGCG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1115502248 14:34060259-34060281 GACAGCCAGCCCCGCCCGGCAGG 0: 1
1: 1
2: 3
3: 23
4: 214
1115502235_1115502244 -6 Left 1115502235 14:34060216-34060238 CCCGAAGGTAGTCGGTAACTGCG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1115502244 14:34060233-34060255 ACTGCGGCGGGCGGCGGCCGGGG 0: 1
1: 0
2: 6
3: 45
4: 368
1115502235_1115502243 -7 Left 1115502235 14:34060216-34060238 CCCGAAGGTAGTCGGTAACTGCG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1115502243 14:34060232-34060254 AACTGCGGCGGGCGGCGGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115502235 Original CRISPR CGCAGTTACCGACTACCTTC GGG (reversed) Intronic