ID: 1115502237

View in Genome Browser
Species Human (GRCh38)
Location 14:34060217-34060239
Sequence CCGAAGGTAGTCGGTAACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115502228_1115502237 -5 Left 1115502228 14:34060199-34060221 CCTGCGCCCGCGGCCGCCCCGAA 0: 1
1: 0
2: 1
3: 38
4: 303
Right 1115502237 14:34060217-34060239 CCGAAGGTAGTCGGTAACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1115502226_1115502237 9 Left 1115502226 14:34060185-34060207 CCACACGCACTGTGCCTGCGCCC 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1115502237 14:34060217-34060239 CCGAAGGTAGTCGGTAACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1115502224_1115502237 26 Left 1115502224 14:34060168-34060190 CCGCGGCGGACACCGAGCCACAC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1115502237 14:34060217-34060239 CCGAAGGTAGTCGGTAACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 24
1115502225_1115502237 14 Left 1115502225 14:34060180-34060202 CCGAGCCACACGCACTGTGCCTG 0: 1
1: 0
2: 1
3: 18
4: 289
Right 1115502237 14:34060217-34060239 CCGAAGGTAGTCGGTAACTGCGG 0: 1
1: 0
2: 0
3: 1
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115502237 Original CRISPR CCGAAGGTAGTCGGTAACTG CGG Intronic